Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21982

FASTA Sequence
Unigene ID: UN21982Length: 1327  SNP
GGGACGTAACTCTAAAAAAACAAAAAATTAAAAAAAAATCAGTTCATCATATCCTCTTTTGAAACCTAAATTAAATTCGATCCGAG
ACGGAAAAGCTCGACGAGTCGCCGGCGGCGGAGTAAAACAAAAACAGTCGGAGCTATGGCGATGCAAACCGGAATCGGCTTATCAA
GGATCTTTCTCTTAGCCGGAGCAGGTTATACTGGTACGATCATGATGAAGAACGGCAAATTATCTGATATATTGGGTGAATTGCAG
TCTCTGGTGAAGGGTATGGAGAGATCGGGAGATGAGGGAGATTCTGATGTGTCCGATGCTATAGCTGCTCAGGTTCGTCGGTTGGC
TATGGAGGTTCGTCAGCTAGCTTCAGCAAGGCAGATAACCGTCATGAATGGAGTTTCTGGTGCAAACTTGCAAGCTCTTGCTGTTC
CTGCTGCGGCGTTGGGAGCTTTAGGATATGGTTATATGTGGTGGAAGGGACTCTCTTTCACTGACCTTATGTATGTGACTAAAGCC
AACATGGCTACTGCTGTGGCTAACTTGACTAAGAATCTGGAGCAAGTTTCAGCCACCCTTGCGGCTGCAAAAAGGCATTTAACGCA
AAAGATTCAGAATATGGATGATAAGGTAGAGCACCAGATTGATCTCTCCAAGGAAATCAAGAACCAGGTCACCTTGGCTCGTGGAG
ATATCAACTCGCTTGAGAGTGAGTTGCAGTCACTGAATGATTTGATTAGTGGTCTGGATGGGAAGTTGGACACGCTGGAATACAAG
CAGGATGTCACAAATGTTTGCATGCTACACTTGTATAACTATTTTGGAGGAAAGAGCACAAAGCTACCTGACATGGAGCAGCTTCA
ACTTCCTGTAAACCAGAAAGCTCGTAATCTGCTTGGAGATGCTGGAACCAAGGGGCTGAAAAACTTTGCTGAACAACTGCTTATAA
GCAATGACACAGAGGGAGGAGCAACCACGGTGAGAAGAATTGGTATAGCCAAGGCCAATGACAAGTCGAGGCCAGTGTTATCAAGG
GTTACTTCAGCTGGGTGTTGATGTGGAAGTTTCCTGATGGTGGTTAGCTTGCGGGATGTATATAACAACAAAACTCTAATACAAAA
TTGTCTCGTGAGCTCACGGTAGAAAGGCTCTCTTATATCTATATTCGTTGGATTGGTTTGTCTCTCCTCCCTCTAAACTATGTTGG
TTTGTACTTTGGGAGTATTTACTTGAACTTGGAGTTTGTTTATTGACATGGGCATGTGTTGTGTCCGCTTTTTTGGACCTTTGAAG
CAAATAAAATAAAGTTGATGTGTGGAGGATTAGTGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564269 uncharacterized protein [Arabidopsis thaliana]12164e-131
AAM61664 unknown [Arabidopsis thaliana]12164e-131
XP_002893364 hypothetical protein ARALYDRAFT_890018 [Arabidopsis lyrata subsp. lyrata]12074e-130
AAF79851 T7N9.6 [Arabidopsis thaliana]9809e-104
CBI32012 unnamed protein product [Vitis vinifera]7934e-082

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8LF07 Putative uncharacterized protein12163e-131
Q9C5M5 At1g27000/T7N9_612163e-131
Q9LFY5 T7N9.69806e-104
B9HV96 Predicted protein7898e-082
B9HJU0 Predicted protein7711e-079

Arabidopsis top hits (Blast detail)Scoree value
AT1G27000.1 bZIP family transcription factor12242e-134
AT2G02730.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT1G27000.1); Has 86 Blast hits to 86 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).6873e-072
AT2G02730.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT1G27000.1); Has 86 Blast hits to 86 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).6873e-072
AT1G04960.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT1G27000.1); Has 95 Blast hits to 94 proteins in 14 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).5063e-051
AT1G04960.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT1G27000.1); Has 95 Blast hits to 94 proteins in 14 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).4571e-045

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1110  38%
 
71  4%
 
105  19%
 
95  19%
 
62  8%
 
122  8%
 
81  4%

Unigene MembersMember information