Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22138

FASTA Sequence
Unigene ID: UN22138Length: 461  SNP
GGAAAAGCAGAACAAGCAACACAAAACACACACAAGACCTGAAACAACTTCAGTTAAGAAAAGAAAAAAGAAAACAAATCATGTCG
GACAAGTGCGGAAGCTGCGACTGTGCTGACAAGACCCAGTGCGTGAAGAAGGGAACCAGCTACACATTCGACATCGTCGAGACTCA
GGAGAGCTACAAGGAAGCCATGTTCATGGACGTTGGTGCAGAAGAGAACGGTTGCCAATGCAAGTGTGGCTCTACCTGCAGTTGCG
TCAACTGCACTTGCAACTAGAACCAAAATGTAATATGAATAAATGTTGATGTGAGCTCATCTAGTAAGCTCATATCTTTCTTTTTT
TTTTTTTTTTTTCACTAAGCTCATATCTTTCTTATGACTCTGTATTATGGTTTATGGTGTGTGATGTAATCGGTTTATGGCCTCTT
ATAATCTAATATATCATATTATCTACATGTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAB85601 metallothionein type 3 [Brassica juncea]3687e-034
ACR46965 metallothionein 3 [Noccaea caerulescens]3435e-031
AAM19713 metallothionein-like protein [Eutrema halophilum]3392e-030
NP_566509 metallothionein 3 [Arabidopsis thaliana]3249e-029
XP_002885083 hypothetical protein ARALYDRAFT_897819 [Arabidopsis lyrata subsp. lyrata]3249e-029

Swiss-Prot top hits (Blast detail)Scoree value
Q96386 Metallothionein-like protein type 32395e-020
P43389 Metallothionein-like protein type 32332e-019
O24059 Metallothionein-like protein type 32162e-017
A3B0Y1 Metallothionein-like protein 3B2135e-017
A2Y1D7 Metallothionein-like protein 3B2118e-017

TrEMBL top hits (Blast detail)Scoree value
Q852U1 Metallothionein type 33685e-034
C5HGE7 Metallothionein 33434e-031
Q8S2R7 Metallothionein-like protein3391e-030
O22433 Metallothionein-like protein3246e-029
Q5SF08 Metallothionein 33156e-028

Arabidopsis top hits (Blast detail)Scoree value
AT3G15353.1 MT3 (METALLOTHIONEIN 3); copper ion binding3247e-031

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
124  31%
 
104  31%
 
61  8%
 
93  23%
 
211  8%

Unigene MembersMember information