Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22235

FASTA Sequence
Unigene ID: UN22235Length: 1666 SSRSNP
GTTCCTATAGACCCATTTTCCTCCTCTCATTCCTCATTTTATTTTTATTTCAAGAAATAACATCTTTTATGTCACCACACAATAAC
CCATAAAATCAAAAATCGTTACCCACATTCTCTCATTCTATCCTAATCCTCATCACTCAAAACAGAGTGCTTAGGCGGAGAAGAAG
AGGAAGAGGAACCAAACATCAAACAACAATGGCTGTCTCAACAATCTACTCAACACAAGCTCTTAACTCAACTCATTTCTTAACCT
CTTCCCCTTCTTCCACCTCCTCCTCCTCAAAACAAGTCTTCTTCTACCGTCGTCAAACCAACCGTAGATTCAACACCATCATCACT
TGCGCTGCACAACAAACCGTCGTGATCGGACTCGCTGCCGACTCCGGATGCGGCAAAAGTACTTTCATGCGGAGGCTGACAAGTGT
CTTCGGTGGAGCCGCCGAGCCACCGAAAGGAGGGAACCCTGACTCCAACACACTCATCAGTGACATGACCACCGTGATCTGTCTCG
ATGATTACCATTCTTTGGACAGAACCGGTCGCAAAGAGAAAGGAGTCACCGCTTTGGACCCACGCGCCAATGACTTTGATCTCATG
TATGAGCAAGTCAAAGCTCTTAAGAGTGGTATCGCCGTCGAGAAACCTATTTATAATCACGTCACTGGACTTCTTGACGCACCTGA
GCTTATTCAGCCTCCCAAGATTCTCGTCATCGAAGGTCTTCATCCAATGTTTGATGAGAGAGTAAGAGACTTGTTGGACTTCAGTA
TCTACCTAGACATTAGCAATGAGGTCAAATTTGCTTGGAAAATCCAGAGGGACATGGCTGAGAGAGGTCACAGTTTAGAGAGCATC
AAAGCAAGTATCGAAGCACGAAAGCCCGATTTCGATGCATTCATCGACCCGCAAAAGCAGTACGCGGATGCGGTAATAGAAGTGCT
TCCAACGCAGTTGATTCCAGATGACAATGAAGGCAAAGTGTTGAGAGTGAGGCTGATAATGAAGGAAGGTGTTAAGTACTTCAGCC
CGGTTTATCTATTCGATGAAGGTTCTACCATCTCGTGGATCCCTTGTGGTCGCAAACTCACCTGCTCGTACCCTGGCATCAAGTTC
AACTACCAACCTGATTCCTACTTCGACAATGAGGTTTCGGTTGTGGAGATGGATGGGCAATTCGATAGACTTGACGAGCTAATTTA
CGTGGAGAGCCATCTGAGCAACCTCTCGACCAAATTCTACGGCGAAGTGACTCAACAAATGCTCAAACATGCTGACTTCCCTGGTA
GCAACAATGGAACTGGTCTTTTCCAGACCATTGTTGGATTGAAGATCAGAGATCTCTATGAGCAGCTCATTGCCAACAAAGCCACT
GCTCCTTCAGAAGCTGCTAAAGCCTAAAGCAAATATAAGCAAAACAGAACGCGTCGATAAACCCATTGGTTGTTTCTTCTTTCTTT
CTTTCTTTCTTTGTTTCCCGCGGATTTTCATGGCGAAAAGGACGGTGTTGCTTGTTTTGTAATTTGTGTGGAGATATAAAAAGAAA
AGCCCGTAATGTAGAGAATTTATTAGCAGAGCAAAAGTTTTTTTTTTCTGAGACTGGTCAAAGTTAACGATTGTATCATCTTATAA
TATAGATTCTATTATAAGATGATCAACTAATC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002890967 hypothetical protein ARALYDRAFT_890765 [Arabidopsis lyrata subsp. lyrata]18895e-209
NP_174486 phosphoribulokinase [Arabidopsis thaliana]18878e-209
XP_002326572 predicted protein [Populus trichocarpa]17703e-195
XP_002303455 predicted protein [Populus trichocarpa]17542e-193
ACJ84919 unknown [Medicago truncatula]17425e-192

Swiss-Prot top hits (Blast detail)Scoree value
P25697 Phosphoribulokinase, chloroplastic18873e-210
P26302 Phosphoribulokinase, chloroplastic17224e-191
P27774 Phosphoribulokinase, chloroplastic17054e-189
P09559 Phosphoribulokinase, chloroplastic16642e-184
P19824 Phosphoribulokinase, chloroplastic14081e-154

TrEMBL top hits (Blast detail)Scoree value
B9MUA4 Phosphoribulokinase17702e-195
B9GZT5 Phosphoribulokinase17541e-193
B7FJJ0 Phosphoribulokinase17423e-192
Q6Z8F4 Phosphoribulokinase17352e-191
Q8GRU9 Phosphoribulokinase17352e-191

Arabidopsis top hits (Blast detail)Scoree value
AT1G32060.1 PRK (PHOSPHORIBULOKINASE); ATP binding / phosphoribulokinase/ protein binding19043e-213
AT3G27440.1 uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative1954e-015
AT3G27190.1 uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative1865e-014
AT1G55810.1 uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative1713e-012
AT1G55810.3 uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative1713e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
198  27%
 
64  13%
 
118  27%
 
122  7%
 
151  3%
 
211  3%
 
83  10%
 
102  7%
 
181  3%

Unigene MembersMember information