Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22259

FASTA Sequence
Unigene ID: UN22259Length: 1757 SSRSNP
GGGGAAGAGGAAGTAGGATGCTAAGGTTTCAATGCTCCCTTCACATTCTTCAGCCTTCTTCTTCTTCTTCGGGGAATAACAACAGC
CTCTCGAGTCTTTGCTTCCACAATTTAGCGCCGTTTCGTGTCACCCGCACGATTCAAGTACCAAAGATCCAAAGGGTACGTGCGGA
TTGGTCCAGGAGGAGTGTAAAAGCGCGAGTAAATGGTCTGGATCAAGGAATGGAAGAAGAAGAAGGAGATGTGGAAGAGTTTGAAG
AAGAAGATGAGTTCAGGTCGAGGGAGAAAGAAATAAGTTACGGAGGGAAGAAGGAGGAGGATATCAATTACGATAAAGATCCTGAG
TTCGCTGATATTCTCGGAGATTGTTTGGATAACCCTGAGAAAGCTCAAAAGAAGATGGAAGAGAGGTTGAGGAAGAAGAGGAATAA
AATTCTTCATACCAAGACTGGTTCTGCTACTTCTATGCAGGTCACATTCAACAAGTTTGAGTATTCGAATTCATACATGTGGTTAG
AGTTTCACAATGCTCCTCTGGATAAAGATATTGCCTTGATCACTGATACAATCCGTTCGTGGCATATCCTTGGACGACTTGGTGGA
TACAACTCCATGAATATGCAATTATCGCAAGCGCCGGTGGATAAGAGGCCAAACTATGATGCTATCCTTGGAGCTAATATCGAGCC
GACCCCATTTTATAACATTGGGGATCTTGAGGTTCAAGACAATGTTGCTCGCATATGGCTAGATATTGGGACCTCGGAGCCGTTGA
TTTTTGATGTTTTGATAAACGCATTGACACAAATCAGCTCAGACTATGTAGGAATCAAGAAACTTGTGTTTGGTGGATTTGAGTTT
TAGAACTGGAAGGAGAATTTGACGTCCGAGGAGTTTGGTTTCAGTGTCCCCAAGATTTAGTATGCTCTTGACGTCCGAGGAGTTTG
GTTTTTCCTTTTATCATTGCAATAAAAACCTATATAAAAACTACATGGTCTAGTTTGATGTATGCATATGCTTAGTTTATCATTTT
ATGACAAATCTCAATAACGTTTATTATGATCAGATTGCAATTATTGCTTGTCTGTGTGAAGCATAAACCATAAACGCTACAAGTCT
GGCACTTGCACGCACTAGGGAGGTGGTTCAAACAAAACTTTTAGCTGTTCAGGAACAATCTTTTAACCTACAAACACTGTCTGAAA
CACTCAAAACGAGCTTATTTAGAAGAAAAATATTTCATTCAATGGCGGATTCTTCAAGCCTGTCTGTTCCTCCTCTTGGGGCCAGA
CTTGGCGACTCTGAGGCCTTTGCTGATCACGCTGAGCCTAGCAAGCGCTGCCTTTTTCAAATCAGGCCTGTAGTAGTTGTCCACAA
CCTGGTTGGCAACAGCTTTAGCCATCCTCGGGAACTCCTTCTTGAGGACAGACTTGTTAACAGAGAGCTTTGGCTTGTTTTGCTTC
TTGGTCTTGGTGGTTCCAAGTACCACACCTTGATCCTTGTCAGCTGGCTGAATGGTCACGGTCTTCTTGTTTGCCAAACCAGAGTG
CTTGTAAGAGTTGAGGTTGCAGAGGTTGTTGCTCTCCTTGCTGAACTGAACCTTAGCATTGCCTCTACCGAACTGTTTCACCAAGA
AACAGTTGTTTCTCTTCACGATCTCCCACACCAGCTGTCCTGGAACTGTTGTCATTTCGATCTCCTAGCAAATTGAATAACTAGAC
AACGGCGGAATAGAGAGAATGAGACTTGTGCCGGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_194669 uncharacterized protein [Arabidopsis thaliana]11881e-127
XP_002869432 oxidoreductase/ transition metal ion binding protein [Arabidopsis lyrata subsp. lyrata]11772e-126
CAB79698 putative protein [Arabidopsis thaliana]11351e-121
XP_002279951 PREDICTED: hypothetical protein [Vitis vinifera]8681e-090
XP_002514171 conserved hypothetical protein [Ricinus communis]8447e-088

Swiss-Prot top hits (Blast detail)Scoree value
Q9M0E2 60S ribosomal protein L28-26732e-069
O82204 60S ribosomal protein L28-16543e-067
Q962T2 60S ribosomal protein L281973e-014
Q3T0L7 60S ribosomal protein L281803e-012
P46779 60S ribosomal protein L281785e-012

TrEMBL top hits (Blast detail)Scoree value
Q5XV66 Putative uncharacterized protein11886e-128
Q9M0E3 Putative uncharacterized protein AT4g2940011359e-122
B9RKC7 Putative uncharacterized protein8445e-088
B9IAB1 Predicted protein (Fragment)8132e-084
B4YYB0 ST45-1096762e-068

Arabidopsis top hits (Blast detail)Scoree value
AT4G29400.1 unknown protein11893e-130
AT4G29410.1 60S ribosomal protein L28 (RPL28C)6741e-070
AT4G29410.2 60S ribosomal protein L28 (RPL28C)6741e-070
AT2G19730.1 60S ribosomal protein L28 (RPL28A)6552e-068
AT2G19730.2 60S ribosomal protein L28 (RPL28A)6552e-068

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
610  20%
 
1215  29%
 
108  16%
 
99  18%
 
118  16%
 
81  2%

Unigene MembersMember information