Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22295

FASTA Sequence
Unigene ID: UN22295Length: 1404  SNP
GGCTGTGGTGGAGAACGAACCGACGTGGAAGACGGATGTTATGGCGGTTCAAGGGTTGGGTTTGGTTAACCCGAAGAATGTGTATA
GATTCTATAATGAGTTACATAGCTACTTGGCTGCTGCTGGTGTGGACGGTGTGAAGGTGGATGTGCAGTGTATATTGGAGACTCTG
GGTGGTGGTTTAGGTGGTCGTGTCGAGTTAACGCGTCAGTATCATCAAGCTCTTGATTCCTCTGTTGCTAAGAACTTCCCTGACAA
TGGCTGCATTGCTTGTATGAGCCATAATACGGATGCTCTCTACTGCTCCAAGCAAGCAGCTGTGATTAGAGCATCAGATGATTTCT
ACCCTCGTGATCCGGTGTCACACACCATCCACATTGCCTCGGTTGCATACAACAGTGTGTTCTTGGGAGAGTTTATGTTGCCAGAC
TGGGACATGTTCCACTCCGTGCACCCTGCTGCAGAGTATCATGCTTCTGCTAGGGCCATTAGTGGTGGACCTATCTACGTTAGTGA
TGCTCCTGGAAAACACAACTTTGATCTTCTAAGAAAGCTTGTGTTGCCTGATGGATCAATCCTTCGTGCTAGATTGCCTGGTAGAC
CAACACGTGATTGTTTGTTCACAGATCCTGCTCGTGATGGTGTCAGCTTGCTAAAGATATGGAACATGAACAAGTACACTGGAGTT
CTTGGCGTGTATAACTGTCAAGGAGCAGCTTGGAGTAGCACAGAAAGAAAAAACATATTCCACCAGACGAATACTGATTGCATCAC
TGGCTCCATTCGTGGTCGTGATGTGCATTTAATCTCCGAGGCCTCCACTGATCCAGCAACATGGAATGGTGACTGTGCTGTTTACT
CTCAGAGCAGAGGTGAACTCATTGTTATGCCATACAACGTGTCTCTCCCGATCTCACTGAAGATCCGTGAGCATGAGATCTTCACT
GTGAGCCCTATTTGTCATCTGGCTACTACCGATGGTGTCTCATTTGCTCCGCTTGGTCTTGTGAACATGTACAACTCGGGAGGAGC
TGTCGAGGGACTTAGATATGATGGTGAGAAGATGAAAGTGGTGATGGAAGTTAAAGGATGTGGTGAATTCGGAGCTTACTCATCGG
TGAAGCCTAAGAGATGCGTTGTTGAGTCAAGCGAGATCGCGTTTGAGTATGATGTCTCCTCTGGTTTAGTCACTTTTGAGTTGGAC
AAGATGCCTTCAGAGGCCAAAACATTACATGTGGTCGAAGTTCAGTTATGGAAGTCATAGCTTGTAACTTGTAAGAGTTGATTCAA
ATAATATTCATTACATTACATGTAAACGGTTTGATTATTGTTGTAGCTACTTTTGGTGTTGTATTCAATCTAGTTATTGAAGTAAT
TTGATGTTCAATAAGTTTTAAGATGATA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33713 unnamed protein product [Thellungiella halophila]20678e-230
XP_002871932 hypothetical protein ARALYDRAFT_910064 [Arabidopsis lyrata subsp. lyrata]20311e-225
NP_197525 putative galactinol--sucrose galactosyltransferase 6 [Arabidopsis thaliana]20132e-223
NP_001190347 putative galactinol--sucrose galactosyltransferase 6 [Arabidopsis thaliana]20132e-223
BAH19983 AT5G20250 [Arabidopsis thaliana]20132e-223

Swiss-Prot top hits (Blast detail)Scoree value
Q8RX87 Probable galactinol--sucrose galactosyltransferase 620191e-225
Q84VX0 Probable galactinol--sucrose galactosyltransferase 112709e-139
Q94A08 Probable galactinol--sucrose galactosyltransferase 212628e-138
Q9FND9 Probable galactinol--sucrose galactosyltransferase 58058e-085
Q8VWN6 Galactinol--sucrose galactosyltransferase7994e-084

TrEMBL top hits (Blast detail)Scoree value
B9IMU8 Predicted protein17451e-192
B9HA87 Predicted protein17342e-191
B9T139 Hydrolase, hydrolyzing O-glycosyl compounds, putative15622e-171
A5C8X4 Putative uncharacterized protein15362e-168
Q575Z7 Alkaline alpha galactosidase 214799e-162

Arabidopsis top hits (Blast detail)Scoree value
AT5G20250.1 DIN10 (DARK INDUCIBLE 10); hydrolase, hydrolyzing O-glycosyl compounds20191e-226
AT5G20250.2 DIN10 (DARK INDUCIBLE 10); hydrolase, hydrolyzing O-glycosyl compounds20191e-226
AT5G20250.3 DIN10 (DARK INDUCIBLE 10); hydrolase, hydrolyzing O-glycosyl compounds20191e-226
AT1G55740.1 AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds12708e-140
AT3G57520.1 AtSIP2 (Arabidopsis thaliana seed imbibition 2); hydrolase, hydrolyzing O-glycosyl compounds12627e-139

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  29%
 
213  21%
 
82  14%
 
102  14%
 
191  7%
 
71  7%
 
201  7%

Unigene MembersMember information