Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22307

FASTA Sequence
Unigene ID: UN22307Length: 741  SNP
TTTTTTTTGTTAATGCCATGATTTCGATAACGGGTAATACTTTGAACGATAATAGTGAAAAGACACGCAAACATAAGCAATTCTGA
CAAAAGATTAAACACATTGTTGGTTCCTTGAAATCATCAAAAACATCATTGTAACTTGACAAAACAAAAGTACTGAGAAACATAGA
AACTAGGTTCATAGATAAGACATCAAAAAAGAAACAGTAGTGTTCTTGAAGAGCTGATCTAAGCCACAAGAGTAGAAGCAGTAGTA
GACTCGTACTTCCAGACTGGAGGAAGCTTCTTGGTCTTCTTGTAGTAACGAGCAAGACGGTGGATCCTGCTCTCGACAAGAATCAA
CCTAAACTTGGAGTCTTTGTCCTTCCTGTTCCTCTCCAAGTGCTTGCGGATAGCAACTGCTTTCTTGATCAAGTGGTACAGATCCT
CAGGAATCTCAGGAGCAAGACCGTGAGCTTTGAGAATACGCAAGATCTTGTTTCCGGTAACACTCTTCACCTGAGGGATACCGTGA
GAGTCACGAAGAATCACACCAATCTGAGATGGTGTCAAACCCTTCTTCGCAAACTTGCAGATCGACTCATCAACATCGACGGCCGT
GGTCTTGAGCCATGTCGGAGGCGAGCGCTTGTACGGCAAAGCAGATGCAGAGATACCCTTTCCTCTGGAATGCATACGCCCCATCT
TGAAGAACTTAGGGTTTGTTCACTGTCTCGATGAGATTGTTTCCTCTGCTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002875045 ATRPS13A [Arabidopsis lyrata subsp. lyrata]7537e-078
NP_567151 40S ribosomal protein S13-2 [Arabidopsis thaliana]7502e-077
NP_567104 40S ribosomal protein S13-1 [Arabidopsis thaliana]7483e-077
XP_002878348 40S ribosomal protein S13 [Arabidopsis lyrata subsp. lyrata]7456e-077
AAK55664 AT3g60770/T4C21_180 [Arabidopsis thaliana]7431e-076

Swiss-Prot top hits (Blast detail)Scoree value
P59224 40S ribosomal protein S13-27507e-079
P59223 40S ribosomal protein S13-17481e-078
P62302 40S ribosomal protein S137193e-075
P46298 40S ribosomal protein S137023e-073
Q69UI1 40S ribosomal protein S13-26834e-071

TrEMBL top hits (Blast detail)Scoree value
Q9MAV9 Cytoplasmic ribosomal protein S137331e-075
Q2V995 Cytoplasmic ribosomal protein S13-like7302e-075
Q3SC82 Cytoplasmic ribosomal protein S137302e-075
B9RDA6 40S ribosomal protein S13, putative7284e-075
A5B3K9 Putative uncharacterized protein7222e-074

Arabidopsis top hits (Blast detail)Scoree value
AT4G00100.1 ATRPS13A (ARABIDOPSIS THALIANA RIBOSOMAL PROTEIN S13A); structural constituent of ribosome7515e-080
AT3G60770.1 40S ribosomal protein S13 (RPS13A)7499e-080

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
620  25%
 
711  14%
 
1216  20%
 
913  16%
 
1011  14%
 
86  8%
 
112  3%

Unigene MembersMember information