Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22355

FASTA Sequence
Unigene ID: UN22355Length: 1779 SSRSNP
CGGCAGAAAATCTTCCTTTTTGATGGCAAAGATGTTTCTCTTAATACTCAAATCAGTAAAAAACAAAATCTAGAAATTGTATTAAA
TAGTTGGAACTAAAACAAAATTTGAAAGAAAAGCAAGCAGCAACCCAAACAAAAGTAACTCAACATTCCACTACTCATGGAGACAC
TTTCTTATTCTTGATTGTCTTCACTCCTCTACGTGGGTTCGGTTTCACTTTCTTCTTCGTCTTCCTACTCGGAGACTCCCTCACTG
GACCAGCCGGGATTCCTTTCTTCAGAGCACTTCCTCTCGGTGTAGCAGACGGAGGCAACCTCAAGTCTTGTGGAGGTAGAGGGCAA
TGAGGCTTCCACACCAAATTGTTCTTCATTGCAAATCTTACTCTCTTTGAGCTCTTCTCACTGCTCGGGCCGGGTAAGCTCTTCTC
TGCTGCATCTCTGTTAACAGTAGCACCTTGCTCCACAACCTCTTTGTTCTCTCTTTTCCTCTTCTTGTTCTTCTTTATGGCTACTG
GAACAGGTTCTGCTTCTTCACAGACACTTGCAACCTCATCTTTCACTGGACCCATTTCGGACGCAATCTTCTCAAACTCCTCCCGA
AGATCTGATATCATAGTCTCGTCAACAGACTCATCTTTCTCGCCATGATTGACAACAACATCAGCTCCCTTCTTCTTAGAATTTGA
ACATTTCTTCAAACTCTTCTTCTTCTTCTTAGAAGAAGACCCATTTGCAACAACCTCCTTAGACTCAGAAACAACTGTCTCAACAG
TCATGGGAACCAGCTCAGGCACTTCATCCTTGTCCCGAGAAGCTTCAGTGATAGAAACCACAACACCAGAGCTCAACATATCCTTC
TCCAACTGCAAAAACTCTTTATGAAGCGCAAATATCACTTTCCTATTCCCCTGATGGCAATCAGGAGAAGAACCCATCTCATAAAA
CCTCTTCCCAAACTCCATAGACAGAGCAATAGATCCCAAAACCACAACATCATCATCCTCCGCCACTCCCTCATCATCCCCATCCC
CAGACTTCTTAACATCAACCAACCTCTTCCCCATCTTAAGCAACTCATCAAACAAATTACTCTTAATCTTCCCAACCAAAACCTTA
TCACTAACAACCCCCATAACCCTCACAAAAGGCACAAACAAAATCTCCAAAACCTCCTTCCTCAACGGAAGAAACGACCTAACCTC
CTCAACGAAAACAGACGCCACGTGGTAGTTAACCCCGTTCCCCTGAAACTTATCCCCAGCCAGAAACGTCCCGTCGAACAAAACAC
CCACCAACCGCCTCGTCAGATCCAAATCCCACGAGCTCGAATCCACGAGAGCGAAGAGCCCGTGCAAGAACCTGCGGATCAAGAGG
TAGAACTTGTCCAACCTCAGCCGGTCGATGCGGGACCACTCGCGGCGCATGGTGAACAGGAACACGGCGAAGTAGTGGACGGAGAG
AGGGAGAGGGAGGGAGTGCAGAGCGGCGGAGAGGCGGTCGATGAGCTGCGACTGGTAGAGAGACTTGTCGGCGTGCCACATGCAGT
AGAAGATGCCTTGCCAGAGCTTCCTCATGTCCTCGTCGGGGATCGAGGTCTGCTCCGGGAGCCATGTGCGGAGGAGGGTTCGCAGG
GAGCGGTCGCGGATGGTTTGCTTGCAGGAGGCGAGCTTCTTTATCAGGGATTTGCAGTTTTCTTCGGCTGGGGATGGTTGTTGTTG
TTGTTGTTGTGGTGCCTCCGAGAGTTGCTTCCGTTTCACCATTGTTATCGCGGAGGAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197560 uncharacterized protein [Arabidopsis thaliana]20562e-228
XP_002874005 hypothetical protein ARALYDRAFT_910101 [Arabidopsis lyrata subsp. lyrata]20123e-223
XP_002267225 PREDICTED: hypothetical protein [Vitis vinifera]12264e-132
XP_002318342 predicted protein [Populus trichocarpa]12211e-131
CAN72961 hypothetical protein VITISV_016489 [Vitis vinifera]9201e-096

Swiss-Prot top hits (Blast detail)Scoree value
Q9Y7M6 Ribosomal RNA-processing protein 1 homolog2719e-023
Q14684 Ribosomal RNA processing protein 1 homolog B2682e-022
Q91YK2 Ribosomal RNA processing protein 1 homolog B2611e-021
P56183 Ribosomal RNA processing protein 1 homolog A2493e-020
P56182 Ribosomal RNA processing protein 1 homolog A2394e-019

TrEMBL top hits (Blast detail)Scoree value
Q8RY12 AT5g20600/F7C8_19020561e-228
B9I4Z2 Predicted protein12211e-131
A5C227 Putative uncharacterized protein9208e-097
B9SR90 Nnp-1 protein, putative8445e-088
A9T0W4 Predicted protein4037e-037

Arabidopsis top hits (Blast detail)Scoree value
AT5G20600.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: rRNA processing; LOCATED IN: preribosome, small subunit precursor; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar, Nop52 (InterPro:IPR010301); Has 444 Blast hits to 431 proteins in 151 species: Archae - 0; Bacteria - 10; Metazoa - 196; Fungi - 114; Plants - 27; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).20593e-231
AT3G22142.1 structural constituent of cell wall1346e-008
AT2G28440.1 proline-rich family protein1167e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  10%
 
122  20%
 
82  20%
 
112  20%
 
211  10%
 
182  20%

Unigene MembersMember information