Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22416

FASTA Sequence
Unigene ID: UN22416Length: 1669  SNP
GCTTCAAGATAAATGTCTGCTCAGAATGTTCCAGTTATAGAAGAGAGATTACAAATTTTGCAAGGGGGAATGTCTTTGTTTTACAA
ATAGTCTTGCATTAGGCAAAGAAGAGGAACAAGCAAATACACACACGATGCTTCACACAATTCACAAAAAGAAAGCAAACTATTAA
TAGCACAAAGCTAGATTTTTAAGAGTGACTGGATCAGCTTCTGGACTTAAATGGGATGGCTCTGATGACTATCACGTGGTACAGAG
CAGCAAGAGCAGCACCGATGAATGGTCCAACCCAAAAGACCCAATGGTCGTCCCAAGCGTTATCCTTGTTGAAGATGATGGCAGCT
CCAAGACTTCTAGCTGGGTTGATTCCAGTTCCAGTGATGGGGATGGTTGCTAAGTGGACCAAGAACACAGCGAATCCAATTGGGAG
AGGAGCAAGAATGGGAACATGAGAGTCACGAGCGTTTCTTTTGGCGTCAGTGGCGGAGAAAACGGTGTAAACGAGGACAAAGGTTC
CAATAATCTCAGCTCCAAGACCACTCCCTTTGGTGTAACCAGGAGCTACAGTGTTGGCTCCACCTCCTAGAGCTTGGTATTGCTTA
GGCTGGAAACCCTTCACCACACCAGCTCCACAAATGGCTCCCAAGCACTGCATCACTATGTAGTACACAGCTCGCGTAAGCGAAAG
CTTCCTGGCCAAGAATAGACCAAACGTGACAGCTGGGTTGATGTGTCCACCGGAGATACCAGCGGTGCAGTAGACGAGAGCGAAGA
TCATACCACCGAAAGCCCAAGCGATCCCTTGGATTCCGACAGAAGCACACATGTTCGGTGCTCTCTTCACGCCCATGACGGTCAAC
ACGGTGATGTAAAGGAACAGAAACGTGGCGATGAACTCGGCGATACCGGCTCTCCAGAAGGACCAGGAAGCAAGCTCGCCTGGCTC
GAACAAGGGAGCAGGAGGTGGCTCCTTGTAGTCCTTGTCGCTCTGAGCCGATGTTCCGATGGGTTGTCTCTCCGGAAACTTGTTAG
CTCCGACTCTAACATCTTCTTCCTTGCCTTCCATTTCTCTCTCTTAAGAGTATTTTTTTCCCATTTTTGGTAATTAAAAAAGGAAA
TTTTCTTTCTTTTTTCTCTTCTTCGCACTTCTAGAGTTTTCCAGGCAAACGTACCAGAAAAGAAACAGAGACAAGCCAGAAGAAGT
ATATAAGCACAAAAGGTGTCTCTGAGAGTTGGAGTGAGAAAGAAGCAATAATGTGTTTGGAGTTTGTGTATCACGAGGAGAAAACA
GAGCTTGGTCGGCAACAAGCACCGGGTGTGTGTCCGTATTGCGGCGGAAAAGTGGCGGCGGTAGATATTGAGACCAAGTGGCTGTT
CTGTTTCTTGCCACTCTGTTTCAAGGTCAAACGCAAGTACACTTGTTCTTCTTGTGATCGTCGTCTCGTCTTGTATTATTGAAAGA
AACAGAGCAAATGAAGAAAGAATATATATTTTATTTATTTGTTGGTTTTACTCTCAGTGTTGAGGTTTTCGCAGATTTTCCCCTGT
AATTTCTTATTTGCTACCAACACCCCTCTTGGTGGTGACATTGGTTAAATTCATTGAGGTTTTGTGGGTTTAATGTAAATAATTTC
GTTGATTACATGAGTTGAATTTCAGCTTTTTAAAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
CAA64896 transmembrane channel protein [Brassica oleracea]15006e-164
BAA92258 plasma membrane aquaporin 1b [Raphanus sativus]14971e-163
ACA50530 putative aquaporin [Brassica napus]14943e-163
AAB61378 aquaporin [Brassica rapa subsp. campestris]14925e-163
AAG23180 aquaporin PIP1b2 [Brassica oleracea]14917e-163

Swiss-Prot top hits (Blast detail)Scoree value
Q06611 Aquaporin PIP1-214878e-164
P61837 Aquaporin PIP1-114662e-161
P61838 Aquaporin PIP1.114662e-161
Q08733 Aquaporin PIP1-314312e-157
Q39196 Probable aquaporin PIP1-414171e-155

TrEMBL top hits (Blast detail)Scoree value
A9X4U3 Aquaporin PIP115004e-164
Q39384 Transmembrane channel protein15004e-164
Q7GCI6 Plasma membrane aquaporin 1c15004e-164
Q9MBA0 Plasma membrane aquaporin 1b14979e-164
B1PRK2 Putative aquaporin14942e-163

Arabidopsis top hits (Blast detail)Scoree value
AT2G45960.1 PIP1B (NAMED PLASMA MEMBRANE INTRINSIC PROTEIN 1B); water channel14885e-165
AT3G61430.1 PIP1A (PLASMA MEMBRANE INTRINSIC PROTEIN 1A); water channel14671e-162
AT3G61430.2 PIP1A (PLASMA MEMBRANE INTRINSIC PROTEIN 1A); water channel14671e-162
AT1G01620.1 PIP1C (PLASMA MEMBRANE INTRINSIC PROTEIN 1C); water channel14322e-158
AT4G00430.1 PIP1;4 (PLASMA MEMBRANE INTRINSIC PROTEIN 1;4); water channel14187e-157

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  8%
 
127  11%
 
75  8%
 
2012  19%
 
83  5%
 
1915  24%
 
1811  17%
 
215  8%

Unigene MembersMember information