Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22457

FASTA Sequence
Unigene ID: UN22457Length: 1037  SNP
GGACCGCTCTTTGTCCTGATTCTAGGGTTTTCGCGACTTGAACATCATCATGGCGACGCAAATCAGCAAGAAGAGGAAGTTTGTGG
CGGACGGTGTGTTCTACGCTGAGTTGAACGAGGTGCTAACTAGGGAGCTAGCAGAGGATGGTTACTCAGGTGTGGAGGTTAGGGTT
ACTCCCATGAGGACTGAGATTATCATCAGAGCCACCCGTACTCAAAATGTTCTCGGTGAGAAGGGAAGGAGAATCAGAGAGTTGAC
GTCCCTTGTTCAGAAGAGATTCAGATTCCCTCAAGACAGTGTTGAGCTTTACGCTGAGAAGGTTGCCAACAGAGGTCTCTGTGCCA
TCGCTCAGGCTGAGTCTCTCCGTTACAAACTCCTCGGTGGTCTTGCCGTTCGCAGGGCTTGCTATGGTGTCTTGAGATTCGTCATG
GAGAGTGGCGCTAAGGGATGTGAGGTCATTGTGAGTGGAAAGCTTCGTGCAGCTCGTGCCAAGTCCATGAAATTCAAGGACGGTTA
CATGGTTTCCTCTGGTCAACCTACCAAGGAATACATCGACTCCGCAGTCAGACATGTTCTGCTCAGACAGGGTGTGCTCGGAATCA
AGGTCAAGGTCATGCTTGACTGGGACCCTAAGGGAGTATTGGGACCAAAGACACCATTGCCTGATGTTGTCATCATCCATTCTCCC
AAGGAAGATGATGTTAGCTCTGCTCCAGCTCAGGTTGCTGCTCCGGCTGCACTTCTACCAGAAGCTCCCCTTACAGCCGTAGATTA
CCCTGAGATGATCCCTGTCGCCTAGAAGATGACTCGTTGGAATGCCTCTCTTTTTTGTCAAACCTTATCATCGTCTCTTTAAGATA
CTTCTTGTTTTTATGTCTTCGAAGCAGACAAGTTTTTTCTCATGTTGTTTTGAAACCTATGTTCAGTTTTTTTGGCAGTTGAATGC
GTTTAGTTCAATGGAACTTTTCGTCTTGAATAATGAATTGTTGCAGTGTAATACGTTTCTCCAAAGTCCAAACGTCTTTTCAACTG
ACCCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_190955 40S ribosomal protein S3-2 [Arabidopsis thaliana]11779e-127
XP_002876229 40S ribosomal protein S3 [Arabidopsis lyrata subsp. lyrata]11761e-126
XP_002870433 40S ribosomal protein S3 [Arabidopsis lyrata subsp. lyrata]11714e-126
XP_002879336 40S ribosomal protein S3 [Arabidopsis lyrata subsp. lyrata]11591e-124
NP_180719 40S ribosomal protein S3-1 [Arabidopsis thaliana]11544e-124

Swiss-Prot top hits (Blast detail)Scoree value
Q9M339 40S ribosomal protein S3-211774e-128
Q9SIP7 40S ribosomal protein S3-111542e-125
Q9FJA6 40S ribosomal protein S3-311505e-125
P02350 40S ribosomal protein S3-A9167e-098
Q90YS2 40S ribosomal protein S39141e-097

TrEMBL top hits (Blast detail)Scoree value
B9DHB0 AT5G35530 protein11435e-123
B9RQV4 40S ribosomal protein S3, putative10324e-110
A9PAW1 Predicted protein10315e-110
B7FH64 Putative uncharacterized protein10243e-109
A9PBQ6 Predicted protein10234e-109

Arabidopsis top hits (Blast detail)Scoree value
AT3G53870.1 40S ribosomal protein S3 (RPS3B)11783e-129
AT2G31610.1 40S ribosomal protein S3 (RPS3A)11542e-126
AT5G35530.1 40S ribosomal protein S3 (RPS3C)11532e-126

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
910  22%
 
89  20%
 
66  13%
 
103  7%
 
115  11%
 
75  11%
 
181  2%
 
201  2%
 
193  7%
 
122  4%

Unigene MembersMember information