Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22491

FASTA Sequence
Unigene ID: UN22491Length: 1129  SNP
GGGACAACCTCCATGTCCAATATATCTCTCACAGCAAGAGAACTCAAAACAGTTTAATTTTCTAAATAACTAGTCTTTTTGGGGTT
TTAGTTGGTATCGTCGGAAGAGAGATAAAAATGTTGGGAATTTTCAGCGGAGCTATAGTATCTTTGCCGGAAGAGCTGGTGGCCGC
CGGGAACCGAACTCCATCGCCGAAGACAACCGGATCGGTCCTAGTCAACAAGTTCGTTGAGAAAAATCCCTCCGCCGTGTCCGTAC
AGGTCGGCGACTATGTGCAGCTTGCGTACAGCCACCACAAAGAGAGTCCTCTCCGGCCAAGGTCATTTGGGGCTAAGGATGAGATA
TTCTGCTTGTTCCAAGGATCACTTGACAACCTAGGAAGCTTGAAACAACAATATGGGCTTGCAAAGAACGCAAACGAGGTTCTCTT
GGTCATCGAGGCTTATAAGACTCTCCGTGACAGAGCTCCTTACCCGGCCAACCATGTCGTGTCTCACCTAAGCGGCGACTTCGCCT
TCGTGGTTTTCGACAAATCAACCTCCACTCTGTTTGTAGCCTCTGACCAAGAAGGTAAGGTTCCATTGTATTGGGGGATAACAGCT
GATGGGTATGTGGCATTTGCTGATGATATTGAGTTGCTAAAAGGTGCTTGTGGCAAATCTCTTGCTTCGTTCCCTCAAGGCTGTTT
TTACTCGACTGCGTTAGGTGGGCTAAGGAGCTTTGAGAACCCTAAGAACAAGATCACTGCCATTCCTGCTAAAGAGGAAGAAATTT
GGGGAGCCACCTTCAAGGTGGAAGGAGCAGCAGTTCTTGCACATGGAGATTGAGAAAAGAAAAAAAAAATCAAGCTCCATCTCTCT
TAATATCGAAACTCCAAAATAATGATGTAGAGAAAACAAGAAGCTGTTCTATGAGTTTTTCTTTAAGCTATCAAATGGTTGGGGAT
GTGTAGTGTTGTGATCTCTGTTTTGTCTTTTGTTTCTCTGTACAGCTTGTGTTTGTCTCTTCTGGTGTTTCTAGTGTGTTCGTCCC
AATAAGTTATGTCTCATAGACTCTAAATCTACCTTCTCTTGATCCTTATATCTCATGTTCAGAACTTGTTTCTCCAGTAAATCCCG
AATTCTCAGTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABV89631 aluminum-induced protein [Brassica rapa]12101e-130
BAA25999 aluminum-induced [Brassica napus]11591e-124
XP_002871864 hypothetical protein ARALYDRAFT_488799 [Arabidopsis lyrata subsp. lyrata]11402e-122
NP_197415 aluminum induced protein with YGL and LRDR motifs [Arabidopsis thaliana]11392e-122
ACF23023 ST7-5-2 [Eutrema halophilum]11195e-120

Swiss-Prot top hits (Blast detail)Scoree value
P24805 Stem-specific protein TSJT12894e-025
Q43011 Asparagine synthetase [glutamine-hydrolyzing]1407e-008
Q54MB4 Probable asparagine synthetase [glutamine-hydrolyzing]1272e-006

TrEMBL top hits (Blast detail)Scoree value
A8IXL5 Aluminum-induced protein12101e-130
O64461 Aluminum-induced11598e-125
Q94BR2 Putative aluminium-induced protein11392e-122
B4YYA6 ST7-5-211194e-120
B9RTW0 Stem-specific protein TSJT1, putative10065e-107

Arabidopsis top hits (Blast detail)Scoree value
AT5G19140.1 AILP111391e-124
AT5G19140.2 AILP18673e-093
AT5G43830.1 unknown protein5206e-053
AT3G22850.1 unknown protein5116e-052
AT3G15450.1 unknown protein4741e-047

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
65  16%
 
104  13%
 
113  9%
 
84  13%
 
124  13%
 
214  13%
 
192  6%
 
93  9%
 
201  3%
 
181  3%
 
71  3%

Unigene MembersMember information