Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22522

FASTA Sequence
Unigene ID: UN22522Length: 1422  SNP
GGATTAAGAAAAACAAAAAAAAACTACAAAAAATATAAATTTTTCTTTTTAATTTTAATAAAACAAAAAAATAAAACAAAAATAAA
ACAATGAGATGCACAAACGTGTCCATTTTATTAGCCTTGGTGATGGTGTTTGTTACACCGATGGTGTTGGCAGATGATGTAACACC
AATTCCAGAGGCCAAAGTTCAAGTGGAGCAGTGGTTCAAGACCAACGTAGCTCCTTTGCCTTCGCGTAAAGGTCTAGATCCTGCTC
TCGTAGCTGCTGAGGCTGAGCCACGTACCATCACCGTGGATCCAAAGGGAGGTGAATTCAAAACACTAACGGACGCAATAAAGAGC
GTTCCTGCAGCGAACACAAAGCGTGTGATCATCAAGATAGCCCCTGGCGAATACAGAGAGAAGGTCACCATCGACAGAAACAAACC
CTTCATTACATTGATGGGAGATCCCAAGGCCATGCCGGTTATTACTTTCGACGGTACTGCCGCAAAGTTCGGTACCGTAGATAGTG
CCACACTCATTATCTTATCCGACTATTTCATGGCTGTCAACATCGTCGTTAAGAATACAGCGCCGGCACCGGATGGTAAAGCGAAG
GGAGCACAAGCTTTATCTATGAGAATCTCTGGAAACAAGGCTGCTTTCTACAACTGTAAATTCTACGGATTCCAAGACACAATTTG
TGACGATACCGGAAACCATTTCTTCAAGGATTGTTACGTCGAAGGGACATTCGATTTCATCTTCGGAAGCGGGACCTCTCTTTACT
TGGGTACACAATTGCACGTGGTGGGAGATGGCATTAGAGTGATAACAGCGCATGCGGGAAAGACCGCAGACGAGAAGACCGGATAC
TCTTTCGTGCATTGCAAGGTGACTGGAGTTGGTCAAGGAATCTATTTGGGTAGGGCATGGATGAGCCACCCTAAGGTTGTCTACGC
CTACACCGAGATGACCAGCGTAGTCAACCCATCTGGATGGCAAGAAAACAAGATAGCCGCACATGACAAGACCGTGTTCTATGGAG
AGTACAAGTGCGTAGGAGAAGGAGCACAGACAGACAAGAGAGTTCCATTTACACAAAAGATTGACACTACTGTAGCTAACCGTTTC
CTTACCCTCGGCTACATTGAAGGATCCAAGTGGCTTCTCCCACCTCCCGCTGTTGCGGCTTCAATATGAATCTAGTTTAAAACTAA
AAACTATATACGTATATACTTATTCACCGAGAGAATGTATATCGGTGTATTTTTTGCTATTTGCGTTGGTTATATTTTTCCAAGAG
TCCTCTCTTCTTAGATGAGACTTGCGTAATTTTGGTTTCATTACGATAATTCATAACCCTTGTATCTTGTCCTAGGGGTCCCAGTT
CCCTTTAATTAATTATATATTATTATTATGATTGAAAGATCGTATT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002871269 ATPPME1 [Arabidopsis lyrata subsp. lyrata]16511e-181
NP_177152 pectinesterase PPME1 [Arabidopsis thaliana]16493e-181
NP_568181 putative pectinesterase 48 [Arabidopsis thaliana]16279e-179
ADH82125 pectinesterase [Brassica rapa subsp. pekinensis]15883e-174
AAM65347 pectin methyl-esterase-like protein [Arabidopsis thaliana]15651e-171

Swiss-Prot top hits (Blast detail)Scoree value
Q84WM7 Pectinesterase PPME116491e-182
Q9LY19 Probable pectinesterase 4816274e-180
Q9FKF3 Putative pectinesterase 6312654e-138
Q9LY17 Probable pectinesterase 5012412e-135
Q9LY18 Probable pectinesterase 4912341e-134

TrEMBL top hits (Blast detail)Scoree value
B9HAS7 Pectinesterase10613e-113
B9I449 Pectinesterase10532e-112
B9NDW1 Pectinesterase10505e-112
Q17ST3 Pectinesterase (Fragment)10301e-109
B9RA18 Pectinesterase10201e-108

Arabidopsis top hits (Blast detail)Scoree value
AT1G69940.1 PPME1; pectinesterase16499e-184
AT5G07410.1 pectinesterase family protein16273e-181
AT5G61680.1 pectinesterase family protein12653e-139
AT5G07430.1 pectinesterase family protein12412e-136
AT5G07420.1 pectinesterase family protein12341e-135

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
79  32%
 
102  7%
 
115  18%
 
182  7%
 
94  14%
 
83  11%
 
63  11%

Unigene MembersMember information