Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22530

FASTA Sequence
Unigene ID: UN22530Length: 1980  SNP
AATCAAACATTTTCTAAGATAAAAGGGAAAACACAATGTAAAGATAATCTTACAAAAGGAACAGACTTAGTTACAAAGCTACAGTA
ACATGCGCAACATTTTTTTTTCTTTTTTTTTTTACATTTTTCTGCTGTCTTTTCAAATAACTGATCAAGACACATGCTTCGAACTT
CTTTTTTTTTCTTGTAGTAAAAGGTCGCAAACTGAGAAGGCCATCCGAACTAGAGACATTCCGCAGTATAAAAGAAAGATGACACC
AAGCTTGTGAATGGGAAAAGCTTCTCAGATTCTCTAATCGTACACACCGAGAAGAACACTATAAAGCAGAGCGAGCAACCGGAATG
GAATGGATTACCCAAAGAAACAGAAGAAGGTGAATCAGCCGACGCTGCGAGATCCGTCTGTGTGTATGTATATAACCAGTTGAGAG
CCCTCTGCCTAGCATTCTAATGCATAAGTCTGCACCTCGGCCAAGTTCTCCTCAGGTGAGCTGTTTGGTGCAGTGAGGTTGGAAGC
AGCAGCTGTGTTGTACCGGAAGATCCTAAGCTTCCCCTCCTTTGTACCATAAACAAGACCTCCTCCAGGAGAAGGATGGAAGCAAG
CGACATTAACTTCATCCTCTGCGCTTGGAAGTATTCTCACCAATTCCATATCTGAAACTCTGTAAATCTCCAACACTGTGAAAAAA
TGTGATGTTGTTTCTCCATCACTCACAATGCTCCTCAAAAGAGAACCATGACGCCGACCATATGCAAGCAATATGTGCTCGGAGTT
TGGAGAGAACTGGATAGAGGTCAAGCAATGTGCAGCCCTAATTGCCCGTGACACAAGTACTGAACCAAATGTTTCCTTTTCGAGAG
AATACACACGAAGTTCATACATGACTTGATGTGCTGTGACAGGATGCCGAGTAGGAGAAGTTGCAAGGCCTGAATCTTGTTGGACC
AGAGTCTGCAAACCAGGATCTGCCTCAGCATGAGGAATAACACATGCTACACAGGCCGCTAAATATTTCCCACATGGCGAAAAATG
AGCTCCCATTTCACTGCAAAGAACAGCGTGATGTATTGCTAATCGGCACTTGTCGGACCTTAGTATTGCACATGGGTCTTTGATGT
CATGTGACCACACTCTAAGTTTGACAGTACAAGGCAACTCTGCAGCAGCAATGGAAGTAGCCAGTTCAGACGGGAGTCTGTTCACC
ACAGGTTGAGCTTCAGTTCCTTCCTGTGGGGCGTTACGAGAGGGAAGACCTCCTGCTAAACCAGATCCTGCGAAGCGGGTTCGGTC
CCTGGAGTGGCCGCTTGCAGAAACCCCATATAAGTTAACACCACCAGGAATTTCTAATGACGCCACTGCAGCCTCTAGACTGGCTG
TGGCTGAATGAGATGCTGAAGAAGAACCTGCATGAGGAGGAGCTGTGCCACTACTACCAGTAGGAAGAACACCAGCCTGGCTTTGA
GCCATCAACCACCCTTGTAGAAAAGGTAACTCCCACGAAACTCTGTCTCTGGAGTGAAATAATTGCTGAAATTGTCCAAAATCAAG
TAGATCTGACTGACTTGACACTTGCCTGGGAATTCTATTTCCTCCAACAGGTTGAGCTTCGTCTATATCCATAGCATCAACGGCTG
TGGTCGAAGCTCTAGCTCTAGCTAGGGAGTTTTCTGGGACATGAGGGGATCCAGCAAGATCGCTGGACATAGCCAAGGGAAGAGGA
GGGGGTGGAGGAGTAGACATTGTTCTGCTGCTGCCGTGTTCTACTGAACTTTGATTACTCTGAAACCTTGATGGAGCACTCCTTGG
ACCAGTAGTAGCAGTGGAATGCTGGATTCTTGGATCATCAGGAGAATATGAAGGCAAAAGCAAGTACGGTAACGGCACAAGTGGGA
GTTCCGCTGCCATACTAGTATGACTGCCACTCTGCGTGTTGGTGAAGAAAATAGCAGGAGGTGGATATCGCAAATAACCTGGAGAT
GC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002892199 transducin family protein [Arabidopsis lyrata subsp. lyrata]21404e-238
NP_563703 transducin/WD-40 repeat-containing protein [Arabidopsis thaliana]15519e-170
BAF01924 hypothetical protein [Arabidopsis thaliana]15519e-170
AAC16752 Contains similarity to neural cell adhesion molecule 2, large isoform precursor gb|M76710 from Xenopus laevis, and beta transducin from S. cerevisiae gb|Q05946. ESTs gb|N65081 gb|Z30910, gb|Z34190, gb|Z34611, gb|R30101, gb|H36304, and gb|N65606 come from this gene [Arabidopsis thaliana]15161e-165
NP_849587 transducin/WD-40 repeat-containing protein [Arabidopsis thaliana]15142e-165

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q0WLT3 Putative uncharacterized protein At1g04140 (Fragment)22391e-249
Q94C94 Putative uncharacterized protein At1g0414022391e-249
O64493 F20D22.9 protein22112e-246
Q93XZ2 AT5G43930 protein15122e-165
Q9FND3 Similarity to unknown protein15122e-165

Arabidopsis top hits (Blast detail)Scoree value
AT1G04140.1 transducin family protein / WD-40 repeat family protein22404e-252
AT1G04140.2 transducin family protein / WD-40 repeat family protein22021e-247
AT5G43930.1 transducin family protein / WD-40 repeat family protein15121e-167
AT5G43930.2 transducin family protein / WD-40 repeat family protein15121e-167
AT5G43930.3 transducin family protein / WD-40 repeat family protein15121e-167

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  13%
 
122  13%
 
87  44%
 
201  6%
 
112  13%
 
211  6%
 
191  6%

Unigene MembersMember information