Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22546

FASTA Sequence
Unigene ID: UN22546Length: 932  SNP
GCCGAGGTCATAACTCAACCATATTTTACACAGAGGAAATGTCTTGTTCTTCAAAAGCAAGCTACTCATTGGGTTTAAGTTGGAAA
ATGTCAATGTTTACAGATGATAAAATCCAGAATCTGGTGATATATATCATATACATAGTTTTTTTTTCTTCCTTTACAGAACGAAA
TTAGAGCTTCATCTTGTGTTACTTCCGGGGTAGATCTCAACAAAATTGATATCATAGAGCAAAGTTGCATTGCCAGGTATGTTACA
GTCACCAGAAAAGCACCCTGCAGGCTCAGGTCCATAAGCTAACTTAGGTGGAATCTGAAGCTTACGCTTCCCCCCTACTCGCATAG
GAGGTACTCCTTCGCCTCCAAGAATCCCTTGGTCTAGACCCCTTATAACCTTGCCGACACCAATCCGCATAGTAAGTGGTCTTGCA
CGCTTATAGGTACTGTCAAACAACGTTCCGTCTGCAAACCTCGCCGTATAGTGAACATTGACAAGTACGCCACGAGGAGCTTTGTC
ACCGAACCCAACAGCGATATCGCAGAATCCAAGCCCTGATTTTGCGTAGCTGTATTCGCAGAGAGGGTCTCCAACAGTGGCGTAGT
ACTCTATCCTCGTGGCGTCTGCATCCAGAGGCGTCAGAGAGAGAATCGTGGCGGCTAAAATGCCTAAACCCACTCCGAAAACGTTC
TTCTTCGCGGCGGTGAAGCTCCTCTGTTTCTGCTGGCAGTCAATGGGAGAAGAAGAACAGAGACACGAGAATGACGATGAAGAAGA
AGAAGAGATGGTGGGTCTGAAGGAACGTGTATAGATAGATGATGTGAGTGTTAAAGTCGAAATCGCCATTGTTGGATTCGTCAGAG
CTTTCTTCCTTCTCTTCTTCCCTTCCCTGTGGGAAGTGCAAGCGTTTGGTCTTGAATCTTCCAAGAGTACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_568067 putative FKBP-type peptidyl-prolyl cis-trans isomerase 4 [Arabidopsis thaliana]9959e-106
XP_002868924 hypothetical protein ARALYDRAFT_490753 [Arabidopsis lyrata subsp. lyrata]9861e-104
ACU15661 unknown [Glycine max]7502e-077
ABK96693 unknown [Populus trichocarpa x Populus deltoides]7394e-076
NP_001190971 putative FKBP-type peptidyl-prolyl cis-trans isomerase 4 [Arabidopsis thaliana]7144e-073

Swiss-Prot top hits (Blast detail)Scoree value
Q9SCY3 Probable FKBP-type peptidyl-prolyl cis-trans isomerase 4, chloroplastic10081e-108
Q9SCY2 FKBP-type peptidyl-prolyl cis-trans isomerase 3, chloroplastic3816e-036
Q6CGG3 FK506-binding protein 22033e-015
P0A0W2 FK506-binding protein1998e-015
P56989 FK506-binding protein1971e-014

TrEMBL top hits (Blast detail)Scoree value
C6T228 Putative uncharacterized protein7502e-077
A9PJZ0 Putative uncharacterized protein7393e-076
B7FMD1 Putative uncharacterized protein7115e-073
B9H567 Predicted protein6892e-070
B9SSL1 Fk506-binding protein, putative6533e-066

Arabidopsis top hits (Blast detail)Scoree value
AT4G39710.1 immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative10099e-110
AT5G45680.1 FK506-binding protein 1 (FKBP13)3816e-037
AT3G25220.1 FKBP15-1; FK506 binding / peptidyl-prolyl cis-trans isomerase2033e-016
AT5G48580.1 FKBP15-2; FK506 binding / peptidyl-prolyl cis-trans isomerase2023e-016
AT2G43560.1 immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein1934e-015

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
713  19%
 
89  13%
 
913  19%
 
119  13%
 
65  7%
 
192  3%
 
105  7%
 
1212  18%

Unigene MembersMember information