Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22648

FASTA Sequence
Unigene ID: UN22648Length: 1345  SNP
GGGGAATCAATAGAATAGAATGGCGAAGGAACTAGCAGAGAAAGCTAAAGAGGCCTTCTTAGATGACGACTTCGATGTGGCCGTTG
ACTTATACTCCAAAGCCATTGACTTGGATCCCTCTTGCGCCGCCTTCTTCGCCGATCGTGCTCAGGCCAACATCAAAACCAATAAC
TTCACTGAAGCTGTTGCAGATGCGAACAAAGCCATCGAGTTGGAGCCTACGTTGGCCAAAGCTTACCTCCGAAAAGGGTACTGCTT
GTATGAAGCTGGAAGAATATAGAACTGCTAAATCAGCCCTAGAGAAAGGCGCTTCTGTTGCACCTAATGAATCAAAGTTTAAGAAG
ATGTTAGATGAATGCAATCTCCGCATTGCAGAGGAAGAGAAAGATTTGGTTCAACAGATGCCACCGACGACTTTGCCTTCAAGCTC
TACAACACCACTAGCAACCGCAGCTGATGCTCCTCCTGTTCCAAGTCCTGCAGCACCTGTCAAACCTATGTTCAGACACGAGTTCT
ATCAGAAGCCAGAAGAAGTGGTGGTGACGATTTTCGCTAAAGGAATACCAAAGCAGAACGTAAATGTTGAGTTTGGTGACCAGATT
CTAAGTGTTGGGATTGAAGTTGGTGGAGAGGAAGCTTATCATTTCCAGCCAAGATTGTTCGGGAAGATAATACCAGAGAAGTGCAG
ATATGAAGTATTGTCAACCAAAGTTGAGATTCGTCTCGCAAAAGCAGAGATGATCACTTGGGCCTCCCTTGAATATAGCAAAGGGC
AAGCTCTTCTGCCTAAACCCAATGTTGCATCAGCGGTTTCACAGAGGCCAGTGTACCCATCTTCCAAGCCTGGAAAAGACTGGGAC
AAGTTGGAAGCTGAAGTGAAGAAGCAGGAGAAGGATGAGAAGCTAGATGGAGATGCAGCAATGAACAAGTTTTTCAGCGATATATA
CCAGAGTGCTGATGAGGACATGAGGCGAGCCATGAACAAATCATTTGCAGAGTCTAATGGGACAGTGCTGTCTACAAACTGGAAAG
AGGTTGGGACTAAGAAAGTGGAGAGCACTCCCCCCGATGGTATGGAGCTCAAGAAGTGGGAATATTGATTTTCTTAAAATCCTCTT
TTCTGGCTTTGTCAAAAATTCGGACAAAATATTTGAACTTGAAAGTTTCTTTTGGTTTTTGCTATAATTTGTCTCTTCATTCTTGC
GTTATGGTCTCATTGTATTAGAAAAGCTCGGAAGGTTGTCATTTACTTTTTTTTTTTTTCAACAGATTTTCATGACATTCTTGCAT
TGTGATCTTAAGTTAGATGTATAAACCCAATTTTCGTTTGAAAAATGTTGTCACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33824 unnamed protein product [Thellungiella halophila]13616e-148
CAF06581 SGT1-like protein [Brassica oleracea]13392e-145
CAF06580 SGT1-like protein [Brassica oleracea]13284e-144
NP_192865 phosphatase SGT1b [Arabidopsis thaliana]13259e-144
ACC91268 phosphatase-related protein [Capsella rubella]11781e-126

Swiss-Prot top hits (Blast detail)Scoree value
Q9Y2Z0 Suppressor of G2 allele of SKP1 homolog4652e-045
Q2KIK0 Suppressor of G2 allele of SKP1 homolog4633e-045
B0BN85 Suppressor of G2 allele of SKP1 homolog4429e-043
Q9CX34 Suppressor of G2 allele of SKP1 homolog4392e-042
Q55ED0 Protein SUGT1 homolog3811e-035

TrEMBL top hits (Blast detail)Scoree value
Q704T1 SGT1-like protein13391e-145
Q704T2 SGT1-like protein13283e-144
Q9SUT5 AT4g11260/F8L21_5013256e-144
B2WS96 Phosphatase-related protein11787e-127
Q9SM53 Putative uncharacterized protein (Fragment)9573e-101

Arabidopsis top hits (Blast detail)Scoree value
AT4G11260.1 SGT1B; protein binding13262e-146
AT4G23570.1 SGT1A; protein binding8943e-096
AT4G23570.2 SGT1A; protein binding8943e-096
AT4G23570.3 SGT1A; protein binding8943e-096
AT2G42810.1 PP5.2 (PROTEIN PHOSPHATASE 5.2); phosphoprotein phosphatase/ protein binding / protein serine/threonine phosphatase1579e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  24%
 
62  12%
 
211  6%
 
85  29%
 
202  12%
 
72  12%
 
101  6%

Unigene MembersMember information