Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22663

FASTA Sequence
Unigene ID: UN22663Length: 965  SNP
GCGCAAGAGTTTTGACGATCTGATACAGAAGAAATAATTTTGTCGGAAAATTCTGTCTTTGTCGGAGGGAAGATCCGTGCATTCCA
TATCGGAAAAGTGTTTCGTTATTCTGCTGTTCGGCGTCGGGTTGATCCATTTGGATACTTGGAAAGATGGATCCTAACCAGCCACC
AGTTGAAAACTATGCGAACCCGAAGACGTGTCTCTTCCATGTTCTCTTCAAGGGTGCTGCGTTGGCGTTTTACATCCTCTCGGCTC
TCTTCTTCAACAGCTTTGTCATTATCTTTGTGGTGACTGTTCTTCTTGCGGCACTTGACTTCTGGGTGGTTAAGAATGTGAGTGGG
CGTATACTGGTTGGTCTCAGGTGGTGGAACGAGATCAATGACTTGGGTGAAAGTGTGTGGAAGTTTGAGTCTCTTGACCAGGAGTC
CTTGGCTCGGATGAACAAGAAAGACTCGTGGCTTTTCTGGTGGACGCTTTACCTTGCAGCAGCTGCGTGGTTAGTCCTTGGGATAT
TTTCACTGATAAGGTTTCAGGCCGACTATCTGCTTGTTGTCGGTGTTTGCTTGTCCCTCAACGTGGCTAATATCATCGGCTTCACA
AAGTGCAAGAAAGATGCAAAGAAACAGTTTCAGCAGTTTGCCTCACAGACAATCGCATCACGGTTCCAATCCACAGTACAATCTGC
CTTCACCCTTGTCTGAAAAGAAGAAAAGGTCTTAGTGAGAGCAAAAACAGTGTACAAAAGAAGATTCGCCATAAGCCACACCATGT
TTTTTTGACTGATTCGTTTTCTCAATATACTATTTTGTAAGGGATTAAGAAAGAGATTTATTATATTATGTCTTCTTACATGTATT
ATCATTTTCGACTTGCCCTGTTTAAGATACTTTTTGAGGTTGTAAAACATTTTGAAAAGATCTCGATGTAGCTTTCACTTTAGCTT
GCTAATATGTTTCCAGTGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_563842 uncharacterized protein [Arabidopsis thaliana]9214e-097
XP_002330023 predicted protein [Populus trichocarpa]8758e-092
XP_002318938 predicted protein [Populus trichocarpa]8731e-091
XP_002512539 Protein FAM18B, putative [Ricinus communis]8613e-090
ACU16785 unknown [Glycine max]8345e-087

Swiss-Prot top hits (Blast detail)Scoree value
Q8LEK2 Uncharacterized FAM18-like protein At1g093309212e-098
Q8IQC1 Uncharacterized FAM18-like protein CG50213549e-033
Q86I95 Uncharacterized FAM18-like protein 13351e-030
Q9Y7K7 Golgi apparatus membrane protein tvp233332e-030
Q6C7V5 Golgi apparatus membrane protein TVP233289e-030

TrEMBL top hits (Blast detail)Scoree value
Q0WRM9 Putative uncharacterized protein At1g093309213e-097
B9N466 Predicted protein8755e-092
A9PJZ6 Putative uncharacterized protein8739e-092
B9I6P4 Predicted protein8739e-092
B9RFM0 Protein FAM18B, putative8612e-090

Arabidopsis top hits (Blast detail)Scoree value
AT1G09330.1 unknown protein9221e-099

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
118  29%
 
66  21%
 
97  25%
 
123  11%
 
82  7%
 
102  7%

Unigene MembersMember information