Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22666

FASTA Sequence
Unigene ID: UN22666Length: 1226 SSRSNP
GGATTTGTTATGATTGAAAGCCACTTCACAAAGAAGAGGGTTTTAGAGTCATGAATTTACTACACAGCGGAAAATAACACAGTTTG
GGAACCAAAAGCCAAATGCACATTTTGAAAAAAAACAGACAAGCAAGTAGAAATGGACTTCCCCAAGAGAATGGTTACTATATTAT
TATTATTACTTACTTACTACTACTCTAAAAACATTATATATACATTCATATAAAGGTTTACCAGAACCGGTTTAGCCTTTTATAAA
AAGCTCTTCTTCTTCTTCTTATTAATCTTACTCACTTGACATGGCAATCGTAAGGAGAAGAAGCAAACACTTGATCTGGAACCACT
AGAGGTAGCTTCTCTATGTACACAAACAGCCTCTTCTTATTCTCCCTCTCCACTGTATGGAGACTGACCGTATCTGATTTCTCCAT
CAACATCCACAGGTCCCCTGAGTTCACTCTCTTCAGACTGTCCCTGCAGAAAGGGCATGACTCTGACCTCCCATGCCAGTCACGGT
AACACTTGATGCATAAAGAATGCGTACAGTTGGGAAGAACAACCATGCTGTTCATCTCCATACATATACCACACTCTTCGTCTCTC
TCCACGTCAATCTCCGAGAGCTTTACTCTTTCCATCTCCTCTTTGTTCCTGTACCTTACTTTGCAGACCTCTTTCTGTTTGCGGTC
ATCCACGTCTGTGATGCCCCTTTCTAGTTGCAACAGCGATGGAAATATCACAGCATAGAAATCTTTAATACTGGTTTTTCTCTCGT
AAACCGACATTGTGGTCTTCCCATCCGCATAGGTCATGTAAATGAGAACTCTGAGCAAACCGAGTGCACCTGCCAGGTGGCAATCA
GTCCACTGGACAAGAAAGAGTAGAAACTGAGCTGCCGGGTTGTAAGATAGCCTCATCTGAACACGAGCTCCATCCTTCTCCCGAGG
ATAATCTAAAGCTACAGTGTTAGCGTGTTGGATATCTGCTTCGAGAGCTTTCAGAGAATCCTTGAACGAAACTCTTGCCATGGAAC
GTCAATTTCCAGCGATGAGAAGAAGAAGAAGAAGGCGAAGATCAGAAGCAAAGAAAAGTTTGATGCTTTAGAAGAGAAGATATTTC
CACACACCCCAAATTCGATGATCGATACTTTCAGAGATGAGAGAAGGATGATGGGTCTTTTGGTAATTTTGTAATTCTAGATAAGC
CTCTTTTGTGCTTTCGGTTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_190300 RING/U-box domain-containing protein [Arabidopsis thaliana]12432e-134
AAM67171 RNA-binding protein-like protein [Arabidopsis thaliana]12432e-134
NP_001190025 RING/U-box domain-containing protein [Arabidopsis thaliana]11358e-122
XP_002525634 ubiquitin-protein ligase, putative [Ricinus communis]10344e-110
XP_002313384 predicted protein [Populus trichocarpa]10174e-108

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8L8R1 RNA-binding protein-like protein12432e-134
Q9SD57 At3g4716012432e-134
B9SI15 Ubiquitin-protein ligase, putative10343e-110
B9HP46 Predicted protein10173e-108
A5BMW9 Putative uncharacterized protein9152e-096

Arabidopsis top hits (Blast detail)Scoree value
AT3G47160.1 protein binding / zinc ion binding12447e-137
AT5G58787.1 zinc finger (C3HC4-type RING finger) family protein10682e-116
AT5G01520.1 zinc finger (C3HC4-type RING finger) family protein8442e-090
AT5G01520.2 zinc finger (C3HC4-type RING finger) family protein6542e-068
AT5G58787.2 zinc finger (C3HC4-type RING finger) family protein5852e-060

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
914  50%
 
63  11%
 
121  4%
 
112  7%
 
102  7%
 
82  7%
 
72  7%
 
201  4%
 
181  4%

Unigene MembersMember information