Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22692

FASTA Sequence
Unigene ID: UN22692Length: 828 SSRSNP
ATATTTTCGTGGCAAAACAAAAGGATCAACACTACAACACAATAGATATATATAATATTTTTGTTGGTCGTAAATAAATGATAAAA
TCAACCATAAAATGAAACCAAAAAACCGACCCATATGAGAAGCATTACATAATAGATACAGTGGCAACACGATTTTACAGCATTTT
TTTTAAGAAGAACAAACGACTTTCAAAGAAAATGGAATCATAATCGTGATACTAAAAGTGGGTTGCTCCAAACTCATCTTAGGAAC
CTTTTTTTTTGTTGTTGTGGGTACTTTCAAGAAAGACAATAAAAAACATAAAATATCATTGCTTTAGATCTCTAAGCAATGTGACT
TTTCTTTAGGGGAGGGGAGGCAAGCAAAATCCATCTTTGTGTCATTCAGGAGTCCACAGCTGGAGATTGCATGCAGCAGAGCCATT
TTTTGGGCTGGGGTTTACTAGGATCACCTCCTCCTCCTCCGGACTTAGCATGACCATCAGTGGATTTACCAGGTGATCCGGGTTTG
CCACCGGTCTTCTTCTCATCCCTAGCTTTGTTGAATATGACTGTGAAACCTTCAGCTGATGCTGGATCGTTCACATCCCATTCACC
AAACTTGGGCAAGGGACGACCTTTGTCCGACATAGGGGTCTGAAGAAAGGAGAGGAAGATTTAATCCCAGAGAATTAATGGAAATA
AACGATTCGAAAGAAAAAGGAGATGAGAGAAAGCCGCCGAGAAAACCAAGGGAAAGTGTGAGAACACAATTGATCGCAGATGAGAG
AGAGAGACAGACTTTTCCTTTTTTTCCTCTTTTTTTCTTTTTCTCTATTATTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAB86938 NOI protein [Arabidopsis thaliana]4089e-038
NP_001190552 RPM1-interacting protein 4 (RIN4) family protein [Arabidopsis thaliana]3991e-036
NP_200396 RPM1-interacting protein 4 (RIN4) family protein [Arabidopsis thaliana]3658e-033
NP_001154782 RPM1-interacting protein 4 (RIN4) family protein [Arabidopsis thaliana]3569e-032
XP_002864413 hypothetical protein ARALYDRAFT_495666 [Arabidopsis lyrata subsp. lyrata]3415e-030

Swiss-Prot top hits (Blast detail)Scoree value
Q8GYN5 RPM1-interacting protein 41218e-006

TrEMBL top hits (Blast detail)Scoree value
O22633 NOI protein4086e-038
B9GFY3 Predicted protein (Fragment)3324e-029
B9I1B3 Predicted protein3262e-028
C6SWS8 Putative uncharacterized protein3111e-026
C6SWK6 Putative uncharacterized protein3012e-025

Arabidopsis top hits (Blast detail)Scoree value
AT5G55850.1 NOI3654e-035
AT5G55850.2 NOI3564e-034
AT2G04410.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).2623e-023
AT5G63270.1 nitrate-responsive NOI protein, putative1801e-013
AT5G40645.1 nitrate-responsive NOI protein, putative1701e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
124  17%
 
117  30%
 
192  9%
 
62  9%
 
101  4%
 
91  4%
 
82  9%
 
201  4%
 
181  4%
 
212  9%

Unigene MembersMember information