Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22807

FASTA Sequence
Unigene ID: UN22807Length: 1679 SSRSNP
CGATGAAAACTGTTTATACATTTAATACTCCACACTTGGAAACAAATGTTTCCATTACAATGGCCCAATCACTTTGCAGTAAAGTT
CTTATATTTCCACATTGCATTACACTTTATTGATCTTTACAAGGAAGCCTCTCTAGAAAAATGACATTTCGACGAGTAGGGGGAGG
AGATAGAAGATAGAGAAAAGAGAGAGAGAGAGCCAAAAAATGGCATCAAGGTTCATCTTTTTGGTAACTCTTATCAAGCGACGAAG
TTGTTTTCAAGTCAAGAAGATATCTTGTGGCCAAGGAAGCGTGAAGGGAAGCACCATAAGGTAGTAAATCTTCATTGACCTCGAAA
TAAGGGGAGTGAGGGCTCGCCATTGGTGAATGAGCTTCGTTTTGCATTCCTAGAAAGCTGAAGTGTCCAGGCATTGCTTCTTGGTA
GAAAGAGAAATCCTCTGATCCCATCAACGGTTGCATCTCGACGTAGTTCTGAGTCCCTAACATGTCACCTGACACGTTCTTGAAGA
ACGTGTGCAAGCTTTGTCGTTAACTGTCGGTGGGAAGAAAGGTTTCTCCTCATTAAGGAAATCTACTGTTGCGTTGCACATATGCA
CGCTCGCTTGCCTCGTGATAACCTGCTCAATTCTTTTCTTGAGTTGGGTAAAGCTTTTAGTTGAAAAGGCTCTGAATGTACCCCCG
ATAGTAACAGAGTCTGGAATCACATTGAAAGCACCACCGCCTTCAAACTTAGCAATTGTAACTACCTGAGAGTCTAAAGGATCTGC
CTCTCGTGAAACGAGGTGTTGTAAGCTAACAACAACGTTAGAAGCTGCCAATATGGGATCTATGGCGTGCTGAGGAAGAGCTGCGT
GACCTCCTTTCCCGCTTATCTTAGCTTCGAATAAGCCACTACCAGCCAACAACGGACCTTCTCTTGAGCTCACTTGGCCTAAACTC
AGTTGGTTTGTAACATGTAACCCAAAGATTGCGCTCACATCCTTCAATACTCCGGCTTCCACGATCTTCTTCGCACCTCCTCCTCC
TTCCTCAGCTGGTTGGAAAACAAGAATCACTGTACCCTGTAGCTCATCTTGGTGTTCTTTGAGCAACTTTGCAGCACCAAGGAGCA
TGGTAGTGTGAGCGTCATGTCCACAAGCGTGCATCTTCCCAGGAATCTTACTCTTGTGCTCCCATTCCACCATCTCCTGCATAGCA
AGTGCGTCCATGTCTGCTCTCAAAGCAACAAAAGGGGCTTGACCAGTTCCGACATAACCAATAACACCAGTAACAGCAACTGGGTA
CTTGAAAGGCACACCCATCTTCTCCAGTTCTGTCCTAACGAGCCTAGACGTCTCTACTTCCTCGTAGCCAAGCTCTGGGTTCTCGT
GGATTTTCCTTCTGATCCCAACCATCCAGTCGAAAAAATCGTCTCTTTTGGCTAAAGCAAGAAACTTTGGAGGGATTTGAGAGAAC
CCATTTGAGTTTAAGGAAGAGGAAGATGAAATCTGACAAGAGTTGAGCAAGTGGATGATGATGATCAAAGCAAAGGAAACCCATTT
GCAGAAACTCATGGCTCTATGAATCGAATCGATTGGGTTCAAAGTTCAAAACCAATCGATTTGGTGTTAGAGAGGAGAGATGAGAT
CGAAGAAGAGAGAGAGAGAGAGTTCTCTGCGTGGTGATGAAGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABB60091 IAA-amino acid hydrolase 3 [Brassica rapa]16932e-186
ABB60090 IAA-amino acid hydrolase 3 [Brassica rapa]16484e-181
NP_175587 IAA-amino acid hydrolase ILR1-like 4 [Arabidopsis thaliana]15321e-167
XP_002891660 IAA-alanine resistant 3 [Arabidopsis lyrata subsp. lyrata]15151e-165
CAA73905 JR3 protein [Arabidopsis thaliana]14801e-161

Swiss-Prot top hits (Blast detail)Scoree value
O04373 IAA-amino acid hydrolase ILR1-like 415325e-169
Q9SWX9 IAA-amino acid hydrolase ILR1-like 513928e-153
Q84XG9 IAA-amino acid hydrolase ILR1-like 111742e-127
Q8S9S4 IAA-amino acid hydrolase ILR1-like 111742e-127
P54970 IAA-amino acid hydrolase ILR1-like 211168e-121

TrEMBL top hits (Blast detail)Scoree value
Q2I747 IAA-amino acid hydrolase 316932e-186
Q2I748 IAA-amino acid hydrolase 316483e-181
A5BUS2 Putative uncharacterized protein13266e-144
B9GVN2 Iaa-amino acid hydrolase 1112917e-140
B9RQ74 IAA-amino acid hydrolase ILR1, putative12853e-139

Arabidopsis top hits (Blast detail)Scoree value
AT1G51760.1 IAR3 (IAA-ALANINE RESISTANT 3); IAA-Ala conjugate hydrolase/ metallopeptidase15324e-170
AT1G51780.1 ILL5; IAA-amino acid conjugate hydrolase/ metallopeptidase13927e-154
AT5G56660.1 ILL2; IAA-Ala conjugate hydrolase/ IAA-amino acid conjugate hydrolase/ metallopeptidase11167e-122
AT5G56650.1 ILL1; IAA-amino acid conjugate hydrolase/ metallopeptidase10602e-115
AT1G44350.1 ILL6; IAA-amino acid conjugate hydrolase/ metallopeptidase8667e-093

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  20%
 
91  10%
 
121  10%
 
201  10%
 
211  10%
 
113  30%
 
71  10%

Unigene MembersMember information