Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22871

FASTA Sequence
Unigene ID: UN22871Length: 1582 SSRSNP
CGAAAACACATGGCTTTAGTTAATAGTTATACGCAAGAGCAAAGTAGCTCATGAGGTTTGGAACGAACCAAAAACTACATAATTCC
TAAGGGGACCAAATCGCCCCATCAAGACATATAACACTCCCTCTCTTAACTTACGATCATGTTGGTGAGTTATACTTTCTTCCAGA
ACACAACAAAGAGGAAAACCATTTTTATTATTGACAGAAACAAATGAAAAGGCATTAAAATACCAAATCTCGTTTCCGAGATTTCA
TTGTGACACTTGCATGAGAAGTTAGTCCAGGAAAAAAAGACCTTTGAGCATCAATTGTAGAAGTCTGTTGGTATCTTTTCACTAAC
AGTGGAACCGAAGTTAGGACCACCCTTGCGATATTGGATAAGAAACTCGACCGGATATCCCTTCAGTTTATGAGGGACAAGGTCCA
AATCCTGAAACGTCAAGGCCTTGTCAGATACAAGTGTATCGGTTGTAAGCGCATTGATTTGATCCAAATTGAATATCTGGGGAGAG
GGTAGAGGGAACGGTACTTTGTTCACCATGAAATCCCGAGGACCCGCCATTGCCTTAGCAATTGGAAATGGAAGCTTCACATATCG
AGGCCATTCACGAATCATATCAAACATGATCTCTGCCAAATCATGAGGGGTAAAGACATCTGGACCACCCAGTTCATAGGTTTTCC
CCATGCTGGAGCCATCATCCTTTAGAGCTGCAACGATTGCAGCAGCAACGTCAACCACGTATACGGGCTGGGATTTGTTGGTTCCG
CCACCTATGAGCGGGAGGAAACCATATTTCTTAACGAACATCGCCCAGGGGTTCAAGATTCTGTCCTCTGTACCAATCATGGTCGC
AGGTCTCATGACTGTCGCCTCCGGTAGAGCGTTCAAGACAGCTTCCTCAGCAGCAGCTTTTGCCCTCTGCATTCTTGAAGGAGATG
ACACAGAAGCTCCCAGACAAGAAACCTGAATAAATCTCATTATCCCACCATGTTCCTTAGCCACCAATGCAAGTTTCTCGGCCATG
TGATGATTCACCTCTTCGAAACTGAAATTTCTGGTCTCGTACTCTCTTCCAATAAGATTGATAACGACATTAGCCTTTGCCATGAC
AGCCTTAATCGAGTCTTCATCTCTTGGATCGAATTTCATCGGTACTACCTGTCCTAAATCTCCCATCAACTTGAGATGTCGAGGAT
TATCCTCTGAGCCTCGGAAAGGAACTAGCACTTGTGATCCCATTTTAGCAAGCTGCTGCACAAGATAACGACCAAGAAACCCAGTG
GCTCCAAACACCGTAGCTACAATGCCACTGACGGAAGATCTGCCACCAGTACCCTTGCGAGCGAGGTGTCCCACGCCCTTTGTAGC
AAGGGAAGACGAGTATCGACGATTATCAGCTCCATCCAGGTGGTGATCGGACACTCCGTAGAGCGATCTGAGAGAAGACGATGAAT
AGATCGAAGCTCCTCCGCCGAGGGGCCGTTGGACTAATCTCCTGGAAACTGCCTGCATCCTCCGAGAGAGACAGAACAACAACAAA
CACAGATGAACGAGAGAGAGAGAGAGAGAGAGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884196 catalytic/ coenzyme binding protein [Arabidopsis lyrata subsp. lyrata]19333e-214
NP_565469 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 9 [Arabidopsis thaliana]19291e-213
BAH20309 AT2G20360 [Arabidopsis thaliana]16502e-181
ACU23211 unknown [Glycine max]15812e-173
XP_002301843 predicted protein [Populus trichocarpa]15794e-173

Swiss-Prot top hits (Blast detail)Scoree value
Q0MQB3 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5486e-055
Q16795 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5486e-055
P34943 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5477e-055
P0CB81 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5477e-055
P0CB82 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5477e-055

TrEMBL top hits (Blast detail)Scoree value
Q9SK66 Putative NADH-ubiquinone oxireductase19297e-214
B9DHU2 AT2G20360 protein (Fragment)16502e-181
C6TJX1 Putative uncharacterized protein15812e-173
B9GRC3 Predicted protein15793e-173
B9IBC6 Predicted protein15731e-172

Arabidopsis top hits (Blast detail)Scoree value
AT2G20360.1 binding / catalytic/ coenzyme binding19349e-217

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  8%
 
92  15%
 
103  23%
 
83  23%
 
211  8%
 
111  8%
 
182  15%

Unigene MembersMember information