Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN22886

FASTA Sequence
Unigene ID: UN22886Length: 983  SNP
GGGCCTCACCTTCGCGTGTGCACACGCGTGTCTTGTTTCTTTATGGTTGCTTTTTCTCGTTATCTAGACACACGATTCTTCCGTTC
AGAAGAGAGATTTATATATAAAGAAAAAGTCAGTTTCAATTGCTTGTCTGTGTTTCGGTTCTGTCTGAACGGTCATTCATCATCAT
CGTCGTCTCCATTACTCCATTAAACCTTTTTCTTGAATCATTACTTGCTTGTGAACGATGAGAAGCCAACAGAGAGATCAAGACTC
GAGGGCTTTCTACGATCTCTCGGCTCTTGTCCTGAGCCTCCTCCGCTCTCCTCCCGTCCCGATTTCTCTCCCCGATCATCATCATC
ACTTCCCGGATTCGCCGATGATGATGAGAAGTCCGCAGCATCGGTCGCTTTCGATGGCGCATATAACTCCCTCCGGATTCGCGTCG
CTGCTGCTGGGTATATCGGTGGCTCTGATGCTCTGTGGATCTGTGACTTTCTTCATCGGCTTCCTCTTGCTGCCGTGGGTCCTGGC
TCTCATCGTGGTTCTTTATGTTGCTGGGATCGTGTCTCTCATTTCCATGGCTGGGAGGTCCATCCTCTCTTACCTCTTGACGCCGC
CTCCTTCTTTTTCATCCATGAAGGAGATTTCTGAATGGAAGCTGTTGTGAAGCGTGACGAACAAACTTCTTGAAATGGCTCTCCTT
TGTTAATCCGGAAGCAGAGGACAAAGAAGATGGATTAATTATATCAACGCAAAATCCAATTAGAGTTTTTCTATATATGTTCTTTT
ATCTGTATTTTGGGGGGTGGGGATTATGTGTGGATATATTTGGGAGTTACTATAGATTTTTTTTTACTTTCTAAAAAATATTTTCT
ATTTTATTGTTAGAGAAATGGGAAAAGCCTGAGTTTGTGCTTTTTTCCATGGATGGTTTTATTGTTATGTGACATTATTTCTTTTA
GAAAAAATAATCATACAAAAGATTATAGGATTTCGAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002890718 hypothetical protein ARALYDRAFT_472924 [Arabidopsis lyrata subsp. lyrata]4993e-048
NP_564274 uncharacterized protein [Arabidopsis thaliana]4904e-047
AAF99728 F17L21.8 [Arabidopsis thaliana]4618e-044
XP_002514895 conserved hypothetical protein [Ricinus communis]3651e-032
ACH87180 unknown protein [Camellia sinensis]3255e-028

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q94F23 Putative uncharacterized protein At1g27290; F17L21.84902e-047
Q9FZK6 F17L21.84616e-044
B9RMC6 Putative uncharacterized protein3658e-033
B5TV75 Putative uncharacterized protein3253e-028
A9PFD3 Predicted protein2895e-024

Arabidopsis top hits (Blast detail)Scoree value
AT1G27290.1 unknown protein4911e-049
AT1G27290.2 unknown protein4911e-049

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
103  16%
 
94  21%
 
64  21%
 
82  11%
 
122  11%
 
113  16%
 
191  5%

Unigene MembersMember information