Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23005

FASTA Sequence
Unigene ID: UN23005Length: 1741  SNP
GGATAGTTAAATATCTGATCCCCCAGTAACAGAGAAAGAGAGTCAGAGAGATCGAAAATGGTGACTAATACTGAAGTGGTATCTCC
CGCGAGCAACGGCGTTGACGGAGGATGTTGCAAGTCAGGTCCTGGTTACGCGACGCCACTCGCCGCCATGTCTGGTCCATCGGAAA
AGCTCATCTACGTCACCGCCGTCTACAGTGGAACGGGACGAGAGAAGCCTGATTACTTGGCAACAGTAGATGTTGATCCAAACTCA
CCAACATATTCAACCGTCATCCACAGGTTACCAATGCCTTTCCTGGGTGATGAGCTTCATCACTCTGGCTGGAACTCTTGCAGCTC
TTGCCATGGTGATGCTTCCGCTGACCGACGTTTTCTCGTCTTACCATCCCTTATATCTGGTCGCATCTATGCGATTGATACAAAGG
CAGACCCGAGGGCACCTTCTTTGTACAAGTACGTGGATCCTAAAGAGATCGCTGATAAGACTGGACTGGCTTATCCACACACAGCT
CATTGTCTTGCCTCTGGTGAAATCTTGGTGTCCTGTCTTGGAGACGAAGAGGGAAACGCCAAGGGGAATGGGTTTCTTCTTCTCGA
CTCTGATTTCAACATCAAGAGCAGGTGGGAGAAAGAAGGACATAGTCCCTTGTTCGGTTATGATTTCTGGTATCAACCCCGGCACA
AGACGATGATAAGCACTTCTTGGGGAGCACCTAAAGCCTTCACCAAAGGTTTCGATCTCCAACACGTTGCTGATGGCTTATACGGA
AGTCATCTCCATGTTTACAGTTGGCCTGGAGGTGAAATGAAACAATTAATTGACCTTGGACCAACTGGCATGTTACCTCTAGAGAT
AAGATTCTTGCATGATCCGTCTAAAGATACAGGGTATGTTGGGGGTGCTCTGTCGAGTAATATGATAAGATTTTTCAAAACAGTGA
TGAAACATGGGGCCATGAGGTGGTTATCCAAGTTAAACCACTGAAAGTAGAGAACTGGATTCTACCAGAAATGCCGGGGCTTATCA
CCGACTTCTTGATCTCCCTCGATGACCGGTTCCTCTACTTTGTGAACTGGCTTCATGGAGACATTCGTCAGTACAACATTGAAGAC
CCTGAAAACCCTGTCTTAACCGGACAAATATGGGTGGGAGGATTACTACAAAAGGGCAGTCCTGTTAAGGCGGTTGGAGAAGACGG
TAACACTTTCCAATATGATGTTCCTCAGATCAAGGGGAAATCTCTAAGAGGAGGACCTCAAATGATCCAGCTGAGCCTCGATGGGA
AACGATTGTATGCAACAAACTCGCTCTATAGTGCATGGGATCGTCAATTTTACCCGGAACTCATGGATAAAGGATCACACATAATA
CAGCTTGATGTTGATACAGAGAAAGGTGGTCTCTCCATAAACCCTGATCTCTTTGTGGACTTTGGTGATGAACCAGAGGGTCCTGC
GCTTGCCCATGAGATGAGGTATCCAGGTGGAGACTGCACTTCCGATATTTGGATTTGAGTCTGGCCTGTTTATATGGTGAGTTGTT
GTGCTACGCTTAAACTGAGTTTTTATTAGTTTGTTGAATAAAAAGCGTAAGTAATAAGAGGTCCCCTATATTTCGTGTGTTGATGG
TGTGTAGACAATTTATACTTTGTTCGTAAAGTTGGCCTCCTTGTGGCTAATAATGCTTTGTAATAAAACTTTCTACATTTCGAGTA
ACACACTATTCGGTTTGTTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002868319 hypothetical protein ARALYDRAFT_915496 [Arabidopsis lyrata subsp. lyrata]14451e-157
NP_193139 putative selenium-binding protein [Arabidopsis thaliana]14397e-157
AAK32898 AT4g14040/dl3061c [Arabidopsis thaliana]13886e-151
E71401 probable selenium-binding protein - Arabidopsis thaliana13851e-150
NP_193140 selenium-binding protein 2 [Arabidopsis thaliana]13842e-150

Swiss-Prot top hits (Blast detail)Scoree value
O23264 Putative selenium-binding protein14393e-158
Q52KZ7 Selenium-binding protein 1-A9026e-096
Q6DCH7 Selenium-binding protein 1-B8972e-095
Q8VIF7 Selenium-binding protein 18928e-095
Q569D5 Selenium-binding protein 18839e-094

TrEMBL top hits (Blast detail)Scoree value
Q9ASS5 AT4g14040/dl3061c13884e-151
Q93WN0 Putative selenium-binding protein13841e-150
Q8L7F3 Selenium-binding protein-like protein13761e-149
O23265 Selenium-binding protein like13177e-143
Q93WS1 Selenium binding protein12926e-140

Arabidopsis top hits (Blast detail)Scoree value
AT4G14030.1 SBP1 (selenium-binding protein 1); selenium binding14393e-159
AT4G14040.1 SBP2 (SELENIUM-BINDING PROTEIN 2); selenium binding13846e-153
AT3G23800.1 SBP3 (selenium-binding protein 3); selenium binding12531e-137

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  5%
 
87  32%
 
96  27%
 
75  23%
 
191  5%
 
181  5%
 
211  5%

Unigene MembersMember information