Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23015

FASTA Sequence
Unigene ID: UN23015Length: 797 SSRSNP
TTTTATCAGGAAACAGTTTATTTGGTACATATTGGTTCATGAATCTTAAACACGAACACACACATATATATATATATATTATACAC
ACAATATCAAACAGAAATTTTCAATAAAAACGAAACTAAAAATATCTCAGTCTCTCTTACCATGAAGAGAAGCAAAGTGATTAATC
AAAGCTAAAGCATTACTCGTTAAATGAGCAATAACCAAAATCCTTTCTCTAACAAAAACCTTAACCTTCCCATTCATGTCATCTCC
TTCAAATCCGTCGGTGCACGTGTTCTCATCGGTCAGAGCCGCACTAACCCATGTCTGAATATCACTCATGTATACCTCATAGCTCG
AGCCACTTAGCTGACCCATCTCACCAATTGATTTCCTAAGCTCATCCAACGTGTCACCTAACTCCTCGACGCAGTCTCTCATGGCC
GAGACTTCTCTTGGCTTGAGCCGTCTACTACTCGAGAGACGCACCATCATTACTGATGTAGCTTTTGCCGAGGCTAATGTGATGTT
GAGAGCCGCGTGAGCCATAAGCTTGGGGCTGGTTTGGATGAGACTGGCATGAGTTGAGAGTGAAGTGACACAGAGTCTTGGATATG
TTGTGACTGTGCATGATGATTTTACGAACTCTGTGTTTGTTGCTGTTGTATGGACCGACTTGAGTGTGGTTATGGTTATGGCTACC
GTTATGAGAAGAGACGTGAGGAAGTGATGAGTAGCTCTAAAAGATTCAGCCATCTCTTTAAAATATATGTTATGAGCTTTATGATA
ATGTTATGATATATGTGTTGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002864788 invertase/pectin methylesterase inhibitor family protein [Arabidopsis lyrata subsp. lyrata]8074e-084
NP_201042 plant invertase/pectin methylesterase inhibitor domain-containing protein [Arabidopsis thaliana]7941e-082
AAN60276 unknown [Arabidopsis thaliana]7941e-082
XP_002510935 21 kDa protein precursor, putative [Ricinus communis]5692e-056
CBA10126 PME inhibitor [Nicotiana benthamiana]5692e-056

Swiss-Prot top hits (Blast detail)Scoree value
P17407 21 kDa protein4066e-039
Q42534 Pectinesterase 22651e-022
O49006 Pectinesterase/pectinesterase inhibitor 32472e-020
O04886 Pectinesterase 12302e-018
P83948 Pectinesterase 32302e-018

TrEMBL top hits (Blast detail)Scoree value
Q8H7E2 Putative uncharacterized protein7941e-082
Q9LVA3 Putative DC1.2 homolog7941e-082
B9R9R0 21 kDa protein, putative5691e-056
C7C5S8 PME inhibitor5691e-056
A5B923 Putative uncharacterized protein5636e-056

Arabidopsis top hits (Blast detail)Scoree value
AT5G62360.1 invertase/pectin methylesterase inhibitor family protein7946e-085
AT5G62350.1 invertase/pectin methylesterase inhibitor family protein / DC 1.2 homolog (FL5-2I22)4326e-043
AT3G47380.1 invertase/pectin methylesterase inhibitor family protein3922e-038
AT4G12390.1 PME1 (PECTIN METHYLESTERASE INHIBITOR 1); enzyme inhibitor/ pectinesterase/ pectinesterase inhibitor3691e-035
AT4G25260.1 invertase/pectin methylesterase inhibitor family protein3691e-035

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
115  25%
 
181  5%
 
191  5%
 
62  10%
 
104  20%
 
92  10%
 
85  25%

Unigene MembersMember information