Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23047

FASTA Sequence
Unigene ID: UN23047Length: 1503  SNP
AACTCTGAGACACACACAGCAAAGAGAAACCGAGTGAAGAAGATAAAGCAAAAAAACAATGGCAACCATTAATTCAACGGTCACGA
TTCTCTCTCCCAAATCGATCCCAAAGATCATCAACTCGAAACTCGGAGTTAGTGTTTCTGATCAGACCGCCGGTTTCTCTCCCAAC
GTTGTGAAATGTGTGAGTTCCTCCTCTTGCCGGAGATTGAAGCTAGCGAAGCTGGTCTCTGCGGCTGGACTGTCGCAGATCGAACC
AGATATCAACGAAGATCCCATTGGTCAGTTCGAGCTTAACAGTATTGAAATGGAGGATTTCAAGTATGGGTATTACGATGGAGCTC
ACACTTATTACGAAGGAGAAGTTGAAAAGGGAACGTTTTGGGGAGCAATTGCAGATGATATTGCTGCTGTGGATCCTCCATCTGGG
TTTCAAGGTTTAATCTCTTGGTTGTTTCTTCCTGCTATTGCGGCTGGGATGTATTTTGATGCTCCGGGTGAGTACTTGTTCATAGG
TGCGGGTTTGTTTACCATAGTGTTCTGTATAATAGAGATGGATAAACCAGACATGCCCCACAACTTCGAACCTCAGATTTACAAAA
TGGAGAGAGGAGCTCGTGACAAGCTCATTAATGACTACAACACTATGAGCATTTGGGACTTTAATGACAAGTATGGTGATATCTGG
GATTTCACCGTCGAGAAGAATGATATCGCCACAAGATAAGATGTTGATTCTTACAAAAAAATGATGATGATATTTGATGAAAACTG
TTTATAAATGATGAATGAAACGTGTTACCATGTGTATAATGTATTCTTCATGTGCTTCATTAGTCTCTTCAAACCTTCCTAGAATG
TTATAGGATTCTGTTTCTTTGTTCAAAAAGTTCACTACAGTCTTCAGATTCGCTTATGTTGTGGAGGGGGTGTTGCCAATCTATAC
TACTAAACCAGAATTTCCAGGATTCTTCCCCTGGTTTTTCAAATAATTACAATCCTCTACCATTGCCTATTTTCGTTTAAAAAAAA
GTCAGATCCCTTTTTTCAACCAATAACTCTTTTGTTTTTACGACCTATCCATAATCTGATCAATTTAAACCCTAACAAATTAGACC
CAGTTCCGACCAAGCCCATGCTTTTAAAAGCCAACAGAATGGATGTTCAGTCCATCGAAATCATCTTGATAATCAAACCCTATGCC
CTGAAATAAAAATGTTTTGGGGTTAAAATCAGTGTTTTGAAACCCGACCCGGACCCGCGGTTGAACCGGTAAACCCGGTGACCCAG
AATAAATCCGGGTTGGGTTTTGTGAAAAACTCAAAATTTAAAAACCCGCAAAAATCCGCTAAAACCCACTAAAACCCAAAACCCGG
TACCGGTTGAACCACCGGTTGAACCAATAAATAACTTTTTTAGTTGTTAATTATATTTTTAAACTTAGATTAAACTTTTTGATTTT
TTATCATATATAATACTAGTTACACTATTTTGTTTGTGATC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002863061 predicted protein [Arabidopsis lyrata subsp. lyrata]9647e-102
AAM62895 unknown [Arabidopsis thaliana]9541e-100
NP_568629 NAD(P)H dehydrogenase 18 [Arabidopsis thaliana]9469e-100
XP_002280020 PREDICTED: hypothetical protein [Vitis vinifera]7182e-073
CAN66763 hypothetical protein VITISV_032729 [Vitis vinifera]6904e-070

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8LE15 Putative uncharacterized protein9547e-101
Q9FG89 Genomic DNA, chromosome 5, P1 clone:MQD199466e-100
A5AI11 Putative uncharacterized protein6903e-070
B9RTG1 Putative uncharacterized protein6832e-069
B7FLH5 Putative uncharacterized protein6796e-069

Arabidopsis top hits (Blast detail)Scoree value
AT5G43750.1 unknown protein9662e-104

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1212  24%
 
99  18%
 
106  12%
 
77  14%
 
115  10%
 
62  4%
 
89  18%

Unigene MembersMember information