Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23065

FASTA Sequence
Unigene ID: UN23065Length: 898  SNP
AGATTCATCGGACTTGTCGTGAAAAATGTCTTAACGTAGGGATTTAGAAAAGAAGGATTTCATTATGATACAAGAATTCAAGAAAC
AAAACATAAAACAAAGGGACCAAAAGAGTGGCACAAGTTCCTTCTTCTGTAACCCTAATTCTCGGACTCAAGAACAGGTCTGGTGC
CACCAGATGTAACAATGTTACCATCACCGTCACTGTTTCCATCTTCATGACCAGAAGAATCTCTAACACTCCGACCACCACCGTTG
AAACTAAACCTAACCCAAATCTCTCTTCCATCATTACTTTTCTTTCCAACCTCATCTCCATCAACAGGCATGTCGTACCTACAAAC
AGGACACGACCCATGAAGCCCTAACCATTTCTCTATGCATCCTCCATGAAATTTATGCTTACACGGCATCTCCTTCACCGTCTCCT
CCGCCTTCCATTCCTCTAGACAAATCACACACTCTCCTACACAGCTAACGACATCAACGTTAGGCATCGCGTCGATGGAAGCCTTG
GACGCTGGAGGATGACCTTCCTCACGTGATTCAAATAAGCCGCGAAGCAGAGGATTCAATCCCGATGACTCCTCGAGGACGATCAT
TCCTTGCGTAAAAGGGTTGACCAGAATGATACGGTCACGCGTCGAAGCAACGTCGTCGTCTCCATGTGATGACTCTTGATCAGAAA
AGCCTAAGAGGAAAGGCAAGAAGGGGTACAAGTCTCTGTTTCTTAGAAATCTTGCGGAAACAGAGGAAGTCTCTCTTACAACTTCA
GCTTCTTGTTCTGTCGCCATAGGAAACAAAAGAATGGAGGATAGATACTAACTGATGGAGTAGATGGCCTTTGACGATTTAAGAGT
TGCAAATGTAAGTTGTGGAAAGATCTAGAAAATGTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564263 RING/U-box domain-containing protein [Arabidopsis thaliana]8685e-091
AAM63417 unknown [Arabidopsis thaliana]8604e-090
XP_002890641 zinc finger family protein [Arabidopsis lyrata subsp. lyrata]8452e-088
XP_002273461 PREDICTED: hypothetical protein [Vitis vinifera]5244e-051
CBI31948 unnamed protein product [Vitis vinifera]4931e-047

Swiss-Prot top hits (Blast detail)Scoree value
Q9CY62 E3 ubiquitin-protein ligase RNF1812061e-015
Q6AXU4 E3 ubiquitin-protein ligase RNF1812023e-015
Q9P0P0 E3 ubiquitin-protein ligase RNF1811881e-013
Q3T0W3 E3 ubiquitin-protein ligase RNF1811872e-013
Q9Y4L5 E3 ubiquitin-protein ligase RNF1151853e-013

TrEMBL top hits (Blast detail)Scoree value
Q9LQX2 At1g26800/T24P13_218683e-091
Q8LCT4 Putative uncharacterized protein8603e-090
A9PB64 Predicted protein4769e-046
A9PIZ7 Putative uncharacterized protein4652e-044
B9HI76 Predicted protein4652e-044

Arabidopsis top hits (Blast detail)Scoree value
AT1G26800.1 zinc finger (C3HC4-type RING finger) family protein8682e-093
AT1G14200.1 zinc finger (C3HC4-type RING finger) family protein3028e-028
AT3G19950.1 zinc finger (C3HC4-type RING finger) family protein2355e-020
AT5G56340.1 zinc finger (C3HC4-type RING finger) family protein2346e-020
AT3G13430.1 zinc finger (C3HC4-type RING finger) family protein2231e-018

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
68  32%
 
122  8%
 
96  24%
 
104  16%
 
84  16%
 
201  4%

Unigene MembersMember information