Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23082

FASTA Sequence
Unigene ID: UN23082Length: 1114  SNP
TCCTGCAAGTAAAGTTTCGGGTTTCAAACAACAAGCAAGCTGTGACTTGCTACTTGTCACAGATAGCAGTGACAAACAAGCACGGT
TAAAGCAGCAACATGCAAACAGAACAGTCACATGACCCAGGGACATAGAAACAAACTAGACCTCAAAAGATTCAAGTTAAGAGTCT
TCCCCCAAATAAGATCCTTGATTGCATAATCTATTTTGGTTCAAAAACAACTCGCTCTATTCCAAAACGGAACAATCTCAATATTC
CCCAATATTAGTTCTAAAACACTCGATTCATTCCATATGTAACATCAACGCAACATAGAATAAAAACCAAAACAAAGAAGCGAATC
AGCAAAACCACGGCAGGACACATCTTGGAACATCTTTTGTTTACTCAAAAGCGTCATCATCATCATCTGGGGAGAGGCTGAGCAGC
GGCGGCAATGAGATCAGCCTCGTTCTTCTGCTGCTCGGCAACGTCGATGTGAACCTCAGGGGGAGCAAGAGCTGGTGACTCAACAA
AGTGAAGGTTAGGGTCGCCTGCAAGTTTCCTAGCGAGGTACAAGAAGGGCTTCTCGAAGTTGTAGTTACTCTTGGCAGATATCTCA
TAGTACTGCAGATTCTTCTTCCTGTGGAACGTCACCTGCTTGGCCTTGACTTGCCTGTTCTTGACATCGACTTTGTTCCCGCAGAG
AACAATAGGGATGTTCTCACACACCCTGCATAGATCACGGTGCCATGTCGGAACGTTCTTGTATGTGAGCCGCGCTGTGACGTCAA
ACATAATCACTGCACATTGACCATGGATGTAGTAACCATCCCTAAGGCCACCGAACTTCTCTTGACCAGCAGTATCCCAGCAGTAG
AAACGGATCTTGCCACAGTTTGTGAAGAAATCCAAAGGATGAACCTCCACACCAATGGTAGGTTCATACTTCTTCTCAAACTCTCC
AGTAAGATGTCTCTTGACGAAAGTGGTTTTCCCTGTGCCTCCGTCACCAACAATGACGAGCTTGAAGCTAGGGTAATCGACGGTTT
GCTGGTTTGGTAGAGCCATGTTTTCGGAGTCGCAGAGAATCAGACGACGTGAGCTTTTAGATAGTAACAAGGAGAGAAGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABD17866 etiolation seedling like-RAN2 small Ras GTP-binding nuclear protein [Brassica napus]11482e-123
CBI21000 unnamed protein product [Vitis vinifera]11276e-121
NP_197501 GTP-binding nuclear protein Ran-1 [Arabidopsis thaliana]11251e-120
NP_197502 GTP-binding nuclear protein Ran-2 [Arabidopsis thaliana]11251e-120
CBI28152 unnamed protein product [Vitis vinifera]11251e-120

Swiss-Prot top hits (Blast detail)Scoree value
P41916 GTP-binding nuclear protein Ran-111254e-122
P41917 GTP-binding nuclear protein Ran-211254e-122
Q8H156 GTP-binding nuclear protein Ran-311059e-120
P41918 GTP-binding nuclear protein Ran-A111022e-119
A2WSI7 GTP-binding nuclear protein Ran-110951e-118

TrEMBL top hits (Blast detail)Scoree value
A9X4K1 Etiolation seedling like-RAN2 small Ras GTP-binding nuclear protein11482e-123
A9X4K0 Putative RAN2 small Ras GTP-binding nuclear protein11257e-121
Q8S2Z7 GTP-binding protein11132e-119
A9X4J9 Putative RAN2 small Ras GTP-binding nuclear protein11104e-119
C6SW66 Putative uncharacterized protein11087e-119

Arabidopsis top hits (Blast detail)Scoree value
AT5G20020.1 RAN2; GTP binding / GTPase/ protein binding11254e-123
AT5G20010.1 RAN-1; GTP binding / GTPase/ protein binding11254e-123
AT5G55190.1 RAN3 (RAN GTPASE 3); GTP binding / GTPase/ protein binding11058e-121
AT5G55080.1 AtRAN4 (Ras-related nuclear protein 4); GTP binding / GTPase/ protein binding7903e-084
AT5G39620.1 AtRABG1 (Arabidopsis Rab GTPase homolog G1); GTP binding2501e-021

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  8%
 
102  8%
 
714  56%
 
64  16%
 
91  4%
 
82  8%

Unigene MembersMember information