Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23096

FASTA Sequence
Unigene ID: UN23096Length: 1228  SNP
GGCAGAAATAATAATGGCCAATAATTCGATTACAAAGGATCAAAACATTACAAAGTCATTGTTATTCAATCAAACAGTAGAGAAAG
AAAACTTTACTTGTTCTTCATGTATGTATCAGCTACTGATATTGATTTCATTCTAGAAGAAAAGGCACATTTAATGGAAACCTTAA
GTTCAGAAAAGGCCCCCATCAAAATAAAAGTGCCAAGCCGAAACATTACCTTCAGGCCATCGATCAAGCTGCTGCAAGTGGCTGAA
GAGCTTTAAGAGGGTTCATGATAACACCATCGATAAGCCCGTAATCTTTTGCTTCTTTAGCGCTCATGAAGAAATCACGGTCTGTG
TCTTGGTTTATCCTCTCAAGGCTTTGACCAGTTTGGTAAGCGAGGTAACCGTTTAGGTTTGCCTTGTGATGCAGCATTTCATTTGC
CTGAATGTCGATATCGGTTTGGCCACCTTGAGCTCCACCAAGCGGCTGATGGATCATTATCCTTGAGTTTGGCAGACTGTATCTTT
TCCCTTTGGTTCCAGCACTAAGCAGAAATGCTCCCATACTAGCAGCTAGACCGACACAAACAGTGGAGACATCAGGTCGGATATGC
CTCATAGTGTCGAATATAGCCATGCCAGCTGTAACTGATCCACCAGGAGAATTCACATACATGACAATATCCTTAGTGGGATCAAC
AGCATCAAGGTAGAGAAGCTGAGCCACGATTATGTTGGCCATATCATCATCAACAGCACCACCACAGCGAATAATCCTATATTGGA
AGAGCTGGCTTATGATACTCTGGAAACGCTCTTGAACCATAGGAGGTGGTCCTTGTCCTTGAGCGTACACAGGAAAGTAAGGCGAA
GAAGGCACTTGTAAATCATCTCTGATGGACCAAACTCCTTGCGGCGAAGGAGTCTCCGGTGTCCAGAGATTGCCGGAGTATACAGC
CTTCGGAGTTGACGAGCTCTTCCAATTCTTTCTGCTGCTAACTAACTTCTTCGTCTTCCTTGAACGAAGGGGCTCGAAAGGGAGAG
AAAGCTTCTGAGAATCGAAAGAGGAGGCGTTGGGACTCGCGGAGACGAATCCAGCTGCAAACCTGAGAGAAGAAGCCGATGTGGAG
ACGCAAGCGTGAGCCATCTTCTTGTCCAACGAAACCCTAATTTCGTCACCGGCGAGGCTTATCCTTCCGAAATTTGGGGATTTTTC
GAAGAGTGACTAATCTGACTACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002889406 hypothetical protein ARALYDRAFT_887394 [Arabidopsis lyrata subsp. lyrata]14825e-162
NP_563657 ATP-dependent Clp protease, protease subunit [Arabidopsis thaliana]14735e-161
XP_002515273 ATP-dependent Clp protease proteolytic subunit, putative [Ricinus communis]12702e-137
ABA41488 ATP-dependent Clp protease proteolytic subunit [Carica papaya]12612e-136
ACU23464 unknown [Glycine max]11993e-129

Swiss-Prot top hits (Blast detail)Scoree value
Q9S834 ATP-dependent Clp protease proteolytic subunit 5, chloroplastic14732e-162
Q3MFR5 ATP-dependent Clp protease proteolytic subunit 16462e-066
Q8YXH5 ATP-dependent Clp protease proteolytic subunit 16434e-066
Q2JIP1 ATP-dependent Clp protease proteolytic subunit 26112e-062
Q0AWF0 ATP-dependent Clp protease proteolytic subunit6093e-062

TrEMBL top hits (Blast detail)Scoree value
B9RND4 ATP-dependent Clp protease proteolytic subunit12701e-137
B8K1W3 ATP-dependent Clp protease proteolytic subunit12611e-136
C6TKM4 ATP-dependent Clp protease proteolytic subunit11992e-129
B9GST6 ATP-dependent Clp protease proteolytic subunit11859e-128
Q93YH0 ATP-dependent Clp protease proteolytic subunit11518e-124

Arabidopsis top hits (Blast detail)Scoree value
AT1G02560.1 CLPP5 (NUCLEAR ENCODED CLP PROTEASE 5); serine-type endopeptidase14794e-164
AT1G66670.1 CLPP3; serine-type endopeptidase4911e-049
AT5G45390.1 CLPP4 (CLP PROTEASE P4); serine-type endopeptidase4741e-047
AT5G23140.1 NCLPP7 (NUCLEAR-ENCODED CLP PROTEASE P7); serine-type endopeptidase4435e-044
AT1G11750.1 CLPP6; serine-type endopeptidase3943e-038

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  9%
 
117  16%
 
96  14%
 
127  16%
 
215  11%
 
83  7%
 
63  7%
 
77  16%
 
192  5%

Unigene MembersMember information