Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23304

FASTA Sequence
Unigene ID: UN23304Length: 818  SNP
AGGGGACTCACTCACATAAACACCTAAAGAAGAAAAACATCAGTCTGAAAAAATGGCACAGGCTACGATGCAGTCTTCTATGGTAG
GAGAGCTTGAGGTAGATGTTGAAATCAAAACCCCCGCCCACAAGTACTACCACATGCTCACCGGAAGACCACAGGATCTTCCGAAA
GTCACTCCTGACAACATCAAGAGATGTGATGTGCTCGAGGGAGAGCCTGGAGAAGTTGGAAGTATCCTATTCTTCAACTATGTCGT
TGATGGACAGCCAAAGGTGGCTAAGAAGAGGATTGAGGCACTGGAGCCGGAGAAGAATCTGATGGTGGCTAGGATAATTGACGGAG
ATCTAATGCAAGAGTTCAAGAGCTTCTTGATCACTGTCCAGGCGACCCCAATGCAAAGAGGACCTGGAAGTGTGGTTAAGTGTCAG
ATGAAGTATGAGAGGATTGACGAGAAGGTGGCTGACCCAGAGAATCTACTTGCGGCTTTTGTCAAAGCATCCAAAGACATGGACAA
AATGCTTTCTTCTGAAGTCTAAGAGGATTCTTTGGATATCTGTTTATCCATCCATCTATCTATGATCTATTATCTGTCCGTCCATC
TATTTATCTATTGTGTCTGGGTGTTTCGCTTGTACTTATCAATAATGTGCTCTCTCTAAGACTGAAGAGATCTAAATATGTAAGTT
TGTAATAATTATACACGATGTCTAGCGTGTTACGTCCGTTTGAAGTTGTGAAAGTTGTAAACCGAATAAGTTGTGTGATGCAACGT
GTTCTCTTCCCAGATCTTAAATTAAGTCCCACAATTCCTCTCTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_564190 polyketide cyclase/dehydrase and lipid transport-like protein [Arabidopsis thaliana]5574e-055
NP_849875 MLP-like protein 28 [Arabidopsis thaliana]4671e-044
NP_177240 MLP-like protein 28 [Arabidopsis thaliana]4671e-044
NP_001077806 MLP-like protein 28 [Arabidopsis thaliana]4671e-044
NP_001117579 MLP-like protein 28 [Arabidopsis thaliana]4671e-044

Swiss-Prot top hits (Blast detail)Scoree value
Q9SSK9 MLP-like protein 284676e-046
Q941R6 MLP-like protein 314514e-044
Q9SSK7 MLP-like protein 344433e-043
Q9SSK5 MLP-like protein 433905e-037
Q9C7I7 MLP-like protein 1653475e-032

TrEMBL top hits (Blast detail)Scoree value
O49304 At1g23130/T26J12_105573e-055
A8MRH3 Uncharacterized protein At1g70830.34678e-045
B3H4F3 Uncharacterized protein At1g70830.54678e-045
Q3E7W3 Putative uncharacterized protein At1g70830.24678e-045
Q3E8Z5 Putative uncharacterized protein At5g28010.14552e-043

Arabidopsis top hits (Blast detail)Scoree value
AT1G23130.1 Bet v I allergen family protein5634e-058
AT1G70830.2 MLP28 (MLP-LIKE PROTEIN 28)4675e-047
AT1G70830.1 MLP28 (MLP-LIKE PROTEIN 28)4675e-047
AT1G70830.3 MLP28 (MLP-LIKE PROTEIN 28)4675e-047
AT1G70830.5 MLP28 (MLP-LIKE PROTEIN 28)4675e-047

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1012  16%
 
68  11%
 
912  16%
 
713  18%
 
1213  18%
 
1113  18%
 
82  3%

Unigene MembersMember information