Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23318

FASTA Sequence
Unigene ID: UN23318Length: 905  SNP
CAGTCCGAAGAACAATAAACTTATTTCAATTAAAATAGCAAACATAACATTTTTCTTTTCAAACTTAGCAACAAAAAACACATTAT
TTTTCATACGAGCACCACGAATGAAAATCGGTCCACCACACTCACTCGTTATGATTCACATCATTATTTTATTTAAAAGCTAGAAA
TATTGATATATCAATAACCATAGAAGAACTCATGGACCTTTATGATCTGAGACACTCGACCAAGGATCTTAAGCCGGTCGGGTAGA
GATTTTGAGATAGCTGGTCGGGCTAAACATCTACGGACCCAATCCATTAGCTTGGGAGTATGGTCCTCCAGGCTAAATTCACCTAT
TGTCTCCCAAGTGTGGAACCAAGGGTAATAAGAGATGAGGACCAAGTCGACCACTGAAACAGTTTCGTTTCCTCCGAAGTAAACCT
TTTCCCCAAGCTCTGTTTCTAATACTTTCAATGTCTCTATAAACTCTCGTTTTGCTTCTTCTTGTTCTTTGCCTTTCTTCGTCCAT
GTTCTTCTTCCTGCGTCAAAAACCTTTTTATCAATTAAATCAGCCCAAAATCTACACTTTGCCTTCTCAAAAGGATCAGAAGGTAG
TAGACGAAGAGTCTTGTCGTCATTCCAGACCTCGTCGATATATTCGAGTATGATATTGGACTCGCATACCGGTTTACCGTTGTGGA
TGAGTACCGGAATTTTCTTGTGAACCGGGTTGGATTGGAGCAATAAATCGGTCTTGTCACCAAATACATCTTCTTCCTTGTACTCG
AATTTGATCTCTTTTTCCTCTAACGCCATGATCACTCTTGCTCCGAACATGCTTGGCCAGAAGTTCAACACGACCACTTTTTCTTC
TGACATTTTTTGGTCTGATATTTTTTTCTTTCTTTATGAAGTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_189966 glutathione S-transferase [Arabidopsis thaliana]10962e-117
AAM63061 glutathione transferase-like protein [Arabidopsis thaliana]10943e-117
XP_002875625 hypothetical protein ARALYDRAFT_905463 [Arabidopsis lyrata subsp. lyrata]10943e-117
BAJ34491 unnamed protein product [Thellungiella halophila]10891e-116
CAA04391 glutathione transferase [Carica papaya]6687e-068

Swiss-Prot top hits (Blast detail)Scoree value
Q03666 Probable glutathione S-transferase6934e-072
P49332 Probable glutathione S-transferase parC6721e-069
P25317 Probable glutathione S-transferase parA6092e-062
P46417 Glutathione S-transferase 36049e-062
P50471 Probable glutathione S-transferase MSR-15502e-055

TrEMBL top hits (Blast detail)Scoree value
Q9LZG7 Glutathione transferase-like protein10961e-117
Q8LDR4 Glutathione transferase-like protein10942e-117
O49821 Glutathione transferase6685e-068
B9I0G5 Predicted protein6506e-066
Q0PN10 Glutathione S-transferase6452e-065

Arabidopsis top hits (Blast detail)Scoree value
AT3G43800.1 ATGSTU27 (GLUTATHIONE S-TRANSFERASE TAU 27); glutathione transferase10975e-120
AT1G17180.1 ATGSTU25 (GLUTATHIONE S-TRANSFERASE TAU 25); glutathione transferase6343e-066
AT1G78360.1 ATGSTU21 (GLUTATHIONE S-TRANSFERASE TAU 21); glutathione transferase6291e-065
AT1G78380.1 ATGSTU19 (GLUTATHIONE S-TRANSFERASE TAU 19); glutathione binding / glutathione transferase6218e-065
AT1G78320.1 ATGSTU23 (GLUTATHIONE S-TRANSFERASE TAU 23); glutathione transferase6163e-064

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
88  31%
 
123  12%
 
62  8%
 
114  15%
 
102  8%
 
77  27%

Unigene MembersMember information