Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN23843

FASTA Sequence
Unigene ID: UN23843Length: 1118 SSRSNP
GGGCCCAACACTTTTGAGTCTTGAAGAAAGGTCATCATCATCATCAACGTGAGAATAATGGCTTCTCTTTGTGCTTCTTCTGCCAT
TGCCGCCATATCTTCTCCTAGCTTCTTGGGAGGCAAGAAACTAAGGCTGAACAAGAAGTTGAGTGTTCCAGCTGTTTCCAAATCAG
CTGCGTCTGTGCGGGCCGTTGCAGCGGATCCCGAGCGACCAATCTGGTTCCCTGGAAGCACTCCTCCAGAGTGGCTCGACGGTAGC
CTCCCTGGTGACTTCGGATTCGATCCTCTTGGTCTTTCATCTGACCCGGATAGTCTAAAATGGAACGTACAAGCAGAGATAGTTCA
CTGCCGGTGGGCAATGCTAGGCGCCGCCGGGATTTTTATCCCGGAGTTTCTAACCAAGATCGGGATCCTCAACACTCCCTCGTGGT
ACACCGCGGGAGAGCAAGAGTATTTCACGGACAAGACCACACTCTTCGTCGTTGAGCTCATCTTAATAGGATGGGCCGAGGGTCGT
AGATGGGCTGATATCATTAAGCCAGGTAGCGTCAACACTGACCCAATCTTCCCAAACAACAAACTGACGGGTACAGACGTTGGATA
CCCGGGTGGGTTATGGTTCGACCCGTTGGGTTGGGGATCTGGCAGCCCGGCTAAGATCAAGGAGCTGAGGACTAAAGAGATCAAGA
ACGGAAGGTTGGCTATGTTGGCAGTGATGGGTGCTTGGTTCCAACATATATACACTGGGACTGGTCCTATTGATAACCTTTTTGCC
CATCTTGCTGATCCTGGTCATGCTACTATCTTCGCTGCTTTCACACCCAAGTGAGACGTCAAGAAAGGAGGATTTGGGAGAGAGAA
TGCGTTTATGTGATCATGTTTGTACAAATATGGTTTTTGAACTTAAAATATTATGTATTTAAGCAAATGGTGGTCGAATTGAAGTT
AGGGTTCGCCGTGTCACTACTCTTTTCCTGACTAAATGCTCATACATTGTGATTCGTGGTATGATAGTCAATCTCTTCTATTCTTT
GTTGGTTAATGCATCTCATGAGAATCATACGCACTTCTAACAACTGCTAATTACAACACCAAACATATCTTCAAATGTAGAGATTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_001147224 chlorophyll a-b binding protein [Zea mays]13623e-148
ABO71660 LhCa2 protein [Brassica juncea]13453e-146
BAJ34383 unnamed protein product [Thellungiella halophila]13419e-146
CAB71077 Lhca2 protein [Arabidopsis thaliana]13364e-145
NP_191706 photosystem I light harvesting complex protein [Arabidopsis thaliana]13355e-145

Swiss-Prot top hits (Blast detail)Scoree value
P13869 Chlorophyll a-b binding protein, chloroplastic11774e-128
P10708 Chlorophyll a-b binding protein 7, chloroplastic11641e-126
P27521 Chlorophyll a-b binding protein 4, chloroplastic6112e-062
Q9SQL2 Chlorophyll a-b binding protein P4, chloroplastic6003e-061
Q36718 Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment)4874e-048

TrEMBL top hits (Blast detail)Scoree value
B6SMV5 Chlorophyll a-b binding protein13622e-148
A4URF4 LhCa2 protein13452e-146
Q9M320 Lhca2 protein13362e-145
Q9SYW8 Lhca2 protein13353e-145
A9PGU3 Putative uncharacterized protein11444e-123

Arabidopsis top hits (Blast detail)Scoree value
AT3G61470.1 LHCA2; chlorophyll binding13361e-147
AT1G19150.1 LHCA6; chlorophyll binding8011e-085
AT3G47470.1 LHCA4 (LIGHT-HARVESTING CHLOROPHYLL-PROTEIN COMPLEX I SUBUNIT A4); chlorophyll binding6155e-064
AT5G28450.1 chlorophyll A-B binding protein, chloroplast, putative / LHCI type II CAB, putative5449e-056
AT1G45474.1 LHCA5; pigment binding4902e-049

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
84  9%
 
114  9%
 
62  5%
 
103  7%
 
73  7%
 
125  12%
 
153  7%
 
1918  42%
 
211  2%

Unigene MembersMember information