Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN24097

FASTA Sequence
Unigene ID: UN24097Length: 1315  SNP
CAAAAAAAAACTATATATATGAAAGTATATGTATTATACAGTGTACAAGAAATATATATTACCTATGCACTAAAAATCCCAAATAA
TCACAACCCCTAATTAACCAATCAACTAAATAAGATCAATGAAGCAAACATAATTAGGATAAATCCCCTAGTAAATCCTATATGTA
TATGTAATAACTACCAACAAATATACTCTTTCACCACAATTAAATAATAAAATAACCATAATTATCCCAAAGCTAGGTAAAATTAT
TCAGTAGTCCCATAAGATCCCCCTCAAGTCACATAGATCTTCATAAGACTTGCTACCGTTCACCATTCCCATCATACTCGTCTCTT
GCTTCATTACCGGACCAGAAGATACCTCCGTGGTCGTGGTCGCGTTCACATCTGAGCTTAGGCATGTTTCTTGAGATACACTAACA
AGAGACTGCTCCATCTTGATCATCTCCCTGTTGTTGTAGTATGTAGAGCCAGAACCAGAAGCAGAACCAAAACTCTGGTGGTTAAA
GATTGGTTGGTAGCTAGAATTGAACTGATGTAGTTGGATTGGTGACGGGGTGTCGTAGGTGGGAGGGTTGATAGGTTTGAAGTTGG
GTTGACCCGTGAAACTCGGATCTATGAGAGGAGGTAGAGATGAGAAGTCTAGGAAATGATCAATGTTCTCTAGAGAATCCGTTCTT
GTGAGATCTCCAGTGGGTATTCTCGTCATTTGTTGAGTTGTAGTGGAAGGATTGTTCTTGTGAAAAACCCTACACACGACCCACTC
GTCCCTTGCGGTTTTGGGGAGATTGTGATAAGAATATATGCCTTCAAGACGATATTCATGCATGACCCAATTCGTCTTTTCACCTC
GTGGAGCTCGTCCTCTATAAAACACAAGTGTTTTCTTCATCCCAACGAGACAACCTTTGCCTTTGAAGATCTCCTTATCCTTCCCG
GTCGCTTTCCAATAACCGGACTCGGTTGCCCGGTTCGTCCTCATACCGGTCGGGTACTTCCTGTCCCTTTGACAGAAGAAGTAAAA
TTCTTTCTCCCCCATCTTTGCCATCTTTGGTAAATCCCAGGGTTCACACTTGTTAAGATCGGCTTCTCCCATGGCCACAGCCGTGA
ATCGGCTGTCTAAAACCTTCTCTTTGAGGTAGGACGATATGATCTCTTCATCTGTTGGATGAAACCTGAATCCAGGTGGTAAATCC
ACAAGCTCTTCCCCTCCATGATTCAACACCACGCCTTCTTCTACTGCAACCGCCATGACTATATAACAGTGTAACAATCTATATGT
GTGTTTGTTTCTCTTTAGTTAAAGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197328 NAC domain containing protein 87 [Arabidopsis thaliana]15677e-172
NP_974800 NAC domain containing protein 87 [Arabidopsis thaliana]15623e-171
XP_002873881 ANAC087 [Arabidopsis lyrata subsp. lyrata]15623e-171
XP_002884425 ANAC046 [Arabidopsis lyrata subsp. lyrata]11171e-119
NP_187056 NAC domain containing protein 46 [Arabidopsis thaliana]10937e-117

Swiss-Prot top hits (Blast detail)Scoree value
O04017 Protein CUP-SHAPED COTYLEDON 26391e-065
Q9S851 Protein CUP-SHAPED COTYLEDON 35942e-060
Q9FRV4 Protein CUP-SHAPED COTYLEDON 15898e-060
Q84TE6 NAC domain-containing protein 21/225127e-051
Q9SV87 Protein BEARSKIN14688e-046

TrEMBL top hits (Blast detail)Scoree value
Q9FK44 NAM (No apical meristem)-like protein15675e-172
Q3E9F9 Putative uncharacterized protein At5g18270.215622e-171
Q9SQQ6 AT3g04060/T11I18_1710935e-117
C0J1R3 NAC domain protein NAC68767e-092
B2ZGR5 NAC domain protein8372e-087

Arabidopsis top hits (Blast detail)Scoree value
AT5G18270.1 ANAC087; transcription factor15682e-174
AT5G18270.2 ANAC087; transcription factor15638e-174
AT3G04060.1 anac046 (Arabidopsis NAC domain containing protein 46); transcription factor10933e-119
AT5G61430.1 ANAC100 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 100); transcription factor7017e-074
AT5G07680.1 ANAC080 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 80); transcription factor6982e-073

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  36%
 
92  18%
 
121  9%
 
71  9%
 
81  9%
 
201  9%
 
181  9%

Unigene MembersMember information