Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN24137

FASTA Sequence
Unigene ID: UN24137Length: 763  SNP
TTTTTTTATTTAATTTAAATACTCAACATTGACCTCTCTCTCTGGATCTTTCTCCAGTTTCCAAATCAAAAATCGATTCCTTTTCT
CCCTAGCAAAACCCTAGCTTCGACGAATCGCTTGCCGTTTCTTCTTCCGAGTCGGATCGAATCGCCATGGCCAAGAGCTCTTTCAA
GCTTTCTAATCCTCTGGAGACAAGGATGAATGAAGCGAGTCGAATCAGAGAGAAGTACCCTGACAGAGTCCCTGTGATCGTGGAGA
AGGCTGGACAGAGTGATGTTCCTGACATTGACAAGAAGAAGTATCTCGTCCCAGCTGATCTAACCGTTGGTCAGTTTGTGTACGTG
GTTCGCAAAAGAATCAAGCTTGGAGCTGAGAAAGCAATCTTTGTCTTTGTCAAAGACACATTGCCTCCAACTGCTGCATTGATGTC
TGCGATCTATGAAGAACACAAAGATGAAGACGGGTTCCTCTACATGACTTACAGCGGAGAGAACACTTTTGGTTCTTTCATTGTTG
CTTGAAATAAGTTAAATTTCCCATCTTTCCATGAATGTACATAGATAAAAAGGAGGAAGATAAGATGTACATTCCTTCCTTATTCT
CTCTGGCTTTTGCTTTTTCTCTTGCTTTGAATCTTTGACATTTGGGTTTATTATAATCTTCACAAACCTTTTCCTTATATACCTTC
TTTTGCATTTTTTTTCAAATTGGAATATTGAATCAATTCCACACAAGAGTAATTGATGTTGAAAACTTGCTCATT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_001078424 autophagy-related protein 8a [Arabidopsis thaliana]6076e-061
XP_002869850 predicted protein [Arabidopsis lyrata subsp. lyrata]6032e-060
NP_567642 autophagy-related protein 8a [Arabidopsis thaliana]5862e-058
AAM62580 symbiosis-related like protein [Arabidopsis thaliana]5852e-058
XP_002874805 hypothetical protein ARALYDRAFT_911720 [Arabidopsis lyrata subsp. lyrata]5664e-056

Swiss-Prot top hits (Blast detail)Scoree value
Q8LEM4 Autophagy-related protein 8a5868e-060
Q9XEB5 Autophagy-related protein 8b5527e-056
A2YS06 Autophagy-related protein 8C5365e-054
Q6Z1D5 Autophagy-related protein 8C5365e-054
Q8S927 Autophagy-related protein 8c5151e-051

TrEMBL top hits (Blast detail)Scoree value
A8MS84 Uncharacterized protein At4g21980.26074e-061
B7E7M3 Putative uncharacterized protein5367e-053
B9RXK4 Gaba(A) receptor-associated protein, putative5367e-053
C5YIC7 Putative uncharacterized protein Sb07g0054405332e-052
B6U3J5 Autophagy-related 8d variant 15295e-052

Arabidopsis top hits (Blast detail)Scoree value
AT4G21980.2 APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase6082e-063
AT4G21980.1 APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase5876e-061
AT4G04620.1 ATG8B (autophagy 8b); microtubule binding5526e-057
AT4G04620.2 ATG8B (autophagy 8b); microtubule binding5526e-057
AT1G62040.1 ATG8C (autophagy 8c); microtubule binding5151e-052

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
126  35%
 
63  18%
 
103  18%
 
203  18%
 
211  6%
 
181  6%

Unigene MembersMember information