Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN24382

FASTA Sequence
Unigene ID: UN24382Length: 1634  SNP
CAGGGGGCAAGCCTGTTGCTGCCTGTGTCATATACAAAAGTCTTCTTCACTGGAGATCATTTGAAGTTGAGAGAACTAACGTCTTT
GACCGTATCATTCAAACAATAGCTTCGGCCATTGAAGTCCCAGATAATAACGAGGTTTTGGCGTATTGGTTATCTAATTCAGCCAC
GCTATTATTGCTTCTGCAACGCACACTTAAAGCTACTGGAGCAGCTAGTTTGACACCACAGAGACGAAGAACATCATCAGCGTCCC
TATTTGGAAGGATGTCACAAGGATTAAGGGCATCTCCTCAAAGTTCTGGACTCTCGTTTCTGAATAGACAGGGGATCACTAAGCTT
GACGACCTGAGGCAAGTTGAAGCGAAGTACCCCGCACTACTTTTCAAGCAGCAGCTTACTGCATTCCTCGAGAAGATATATGGAAT
GATCAGAGATAATCTAAAGAAAGAGATCTCTCCTCTTCTTGGGTTATGTATTCAGGCACCAAGGACATCAAGGGCAAGTTTGGTGA
AAGGGAGAGCACAAGCAAATGCTGTTGCTCAACAAGCTCTAATTGCCCATTGGCAAAGTATTAGGAAAAGCCTAAACGCTTACTTG
AATCTCATGAAAACAAACAACGCTCCACCGTTCTTAGTCCGCAAAGTATTCACACAAATATTCTCCTTCATCAATGTTCAGCTTTT
CAACAGTCTTCTTCTACGTCGTGAATGTTGCTCATTCAGCAACGGCGAGTACGTTAAAGCAGGCTTGGCTGAATTAGAGCAGTGGT
GTACAGAGGCTACGGATGAATATGCGGGCTCTGCTTGGGATGAGTTGAGACATATCAGGCAGGCAGTTGGTTTCCTGGTCATTCAT
CAAAAGCCGAAAAAGACCTTGGACGAAATAACAAGAGAACTCTGTCCGGTGCTAAGTATACAGCAGCTATATAGAATCAGCACAAT
GTACTGGGATGATAAATATGGCACTCATAGCGTTTCTTCAGATGTTATTGCAAACATGAGGGTTATGATGACCGAGGACTCGAACA
ATGCCGTAAGCAGCTCTTTCCTTTTGGACGATGACTCAAGCATTCCATTCACGGTGGAAGACATATCAAAGTCAATGCAGCAAGTG
GATGTAAATGACATTGAGCCTCCTCAACTGATCCGTGAAAACTCAGGTTTCGGATTCTTACTCACACGTAAAGAAGGCAGTGCATC
ATAAGTGAGCTCTCTGTACGGTCCACCAAATACGATTGTTTCTGCTGCATATACATAAAAACATCGTGTGGCCCTTTGCATTTTTA
TGGGCATTTTGTGTATATTATTTTTCTTTCATTCTCTTCTTGATTTTGGTGCTCAGTCTCTGGCCTTTGTATTTGTGGAAAGGCCG
AGTTTGTTTCATTCTTTGCATCCCTGTAGTTATGGCAACTCGCAGGGGGTTATTTGTTGCTTTTGTCATAGAAAGTCTTAGATGTG
TTCGATGCTGTCCTGTCCAGAGAGGGGAGGAGAGTATTGTTGTTTTAGTCAATTATTTGTATTTGTTGGTTTGGGCGAGTCTTTAT
AATCGTTGTGTGAAATTGTAATGAAGGAACTAGACTTTGTTTTCCCTATTTTATTATAGGTTTCACATCAAATACCTTTCACATGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197549 Myosin family protein with Dil domain [Arabidopsis thaliana]19827e-220
NP_001154724 Myosin family protein with Dil domain [Arabidopsis thaliana]19827e-220
ADV74830 myosin XI-K [Arabidopsis thaliana]19827e-220
XP_002873998 predicted protein [Arabidopsis lyrata subsp. lyrata]19244e-213
XP_002309201 predicted protein [Populus trichocarpa]18582e-205

Swiss-Prot top hits (Blast detail)Scoree value
P54696 Myosin-H heavy chain1893e-013
Q9ULV0 Myosin-Vb1614e-010
P70569 Myosin-Vb1598e-010
Q9QYF3 Myosin-Va1562e-009
P21271 Myosin-Vb1552e-009

TrEMBL top hits (Blast detail)Scoree value
Q3E994 Putative uncharacterized protein At5g20490.119825e-220
B9HDW1 Predicted protein18581e-205
B9RK43 Myosin XI, putative18364e-203
B0CN61 Myosin XI-K17612e-194
Q5R216 Myosin XI17612e-194

Arabidopsis top hits (Blast detail)Scoree value
AT5G20490.1 XIK; motor/ protein binding19832e-222
AT5G20490.2 XIK; motor/ protein binding19832e-222
AT1G54560.1 XIE; motor/ protein binding16231e-180
AT1G08730.1 XIC; motor/ protein binding16032e-178
AT1G17580.1 MYA1 (MYOSIN 1); motor/ protein binding14572e-161

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
212  17%
 
82  17%
 
62  17%
 
122  17%
 
92  17%
 
102  17%

Unigene MembersMember information