Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN26143

FASTA Sequence
Unigene ID: UN26143Length: 1336  SNP
GGGACTCAGCCGTCCGTTTCACATCATTTGGAGTTGCAGCAGAGGAGGACGACAATGGCCCCGAAGAAAGGAGTGAAGGTAGCTGC
CAAGAAGAAGACGGAGAAAGTAACGAACCCTCTGTTCGAGAGGAGGCCTAAGCAATTCGGTATCGGAGGAGCTCTTCCTCCAAAGA
AGGATCTGACTCGCTACATCAAATGGCCTAAGTCAATCCGTCTCCAAAGGCAGAAGCGTATCCTTAAGCAGAGGCTCAAGGTCCCC
CCGGCTTTGAACCAGTTCACCAAGACTCTTGACAAGAACCTTGCCACCCAGCTCTTCAAGGTTCTTATGAAGTACAGACCAGAGGA
CAAGGCCGCCAAGAAGGATCGTCTTCTCAAAAAGGCTCAAGCCGAGGCCGAGGGAAAGCCTTCTGAATCCAAGAAGCCCATTGTCG
TCAAGTACGGACTCAACCACGTCACTTACCTCATCGAGCAGAACAAGGCACAGCTTGTCGTCATTGCGCACGATGTTGACCCCATC
GAGTTGGTCGTCTGGTTGCCTGCTCTTTGCAGAAAGATGGAAGTGCCTTACTGCATTGTTAAAGGCAAATCTCGTCTTGGAACGGT
CGTTCACCAGAAGACTGCTGCTTGCTTGTGTTTGACAACTGTCAAGAACGAGGACAAGCTAGAGTTCAGCAAGATCCTTGAGGCCA
TCAAGGCAAACTTCAACGACAAGTACGAGGAGTACAGGAAGAAATGGGGAGGAGGCATCATGGGATCCAAATCGCAGGCGAAGACA
AAGGCCAAGGAAAGGGTTCTTGCGAAAGAGGCTGCCCAAAGGATGAACTAAGATGCATATCTTTTATTATTGTCTGTCATTTGCTG
GGATTATCGTAAAACTTGATAGACCTCTTTTTTGTTTAGCTGTTGGAACTCTTGTTTTGTTTTTATTATGGATGTTTTGAGCACTT
TCTTCATACTGCTTCCATCTTCTTGAAGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGGCTCTTTCGCTCCT
CATTTTCGGTCCATTTGTTGACTATTTCTTGAGCGGCAGATTCATTACTACTTACAAGATGACTTACGGTGCCATTTTCTGCATTC
TTCTCTCCTGCGCATTGGCGGTTTTCTGCAACATAAGCCAATACCTCTGCATCGGGAGATTCTCTGCTACCTCATTCCAAGTTCTC
GGACACATGAAAACGGTCTGTGTCCTGACGTTAGGATGGCTTATCTTTGACTCCGAGATGACGTTCAAGAACGTAGCGGGGATGTT
CTTAGCCGTGGTGGGAATGGTGATTTACAGCTGGGCGGTCGAGTTA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880315 60S ribosomal protein L7A [Arabidopsis lyrata subsp. lyrata]12755e-138
XP_002878483 60S ribosomal protein L7A [Arabidopsis lyrata subsp. lyrata]12721e-137
NP_182283 60S ribosomal protein L7a-1 [Arabidopsis thaliana]12693e-137
NP_191846 60S ribosomal protein L7a-2 [Arabidopsis thaliana]12641e-136
ACU19332 unknown [Glycine max]11842e-127

Swiss-Prot top hits (Blast detail)Scoree value
P49692 60S ribosomal protein L7a-112691e-138
Q9LZH9 60S ribosomal protein L7a-212644e-138
P35685 60S ribosomal protein L7a11571e-125
O57592 60S ribosomal protein L7a7708e-081
P46223 60S ribosomal protein L7a7662e-080

TrEMBL top hits (Blast detail)Scoree value
C6TBY0 Putative uncharacterized protein11841e-127
B9SIW8 60S ribosomal protein L7a, putative11625e-125
A5BD49 Putative uncharacterized protein11591e-124
A9PE97 Putative uncharacterized protein11581e-124
A2Z2X9 Putative uncharacterized protein11572e-124

Arabidopsis top hits (Blast detail)Scoree value
AT2G47610.1 60S ribosomal protein L7A (RPL7aA)12708e-140
AT3G62870.1 60S ribosomal protein L7A (RPL7aB)12653e-139
AT1G21070.1 transporter-related5233e-053
AT1G76670.1 transporter-related5063e-051
AT5G42420.1 transporter-related4373e-043

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
73  12%
 
118  31%
 
124  15%
 
104  15%
 
61  4%
 
92  8%
 
81  4%
 
202  8%
 
191  4%

Unigene MembersMember information