Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN30837

FASTA Sequence
Unigene ID: UN30837Length: 748 SSR 
GGGATTAATCGAAGCAGAGAGAGAGAGAGAGAGATCGGGGGGCGTAATGGACGAGGTGATGACAGTGGCGGACGCCGGCGGAAACA
GGGCATTGTACGGATCTCCTCCGTCGCAGAACCAGTTTCCTCACAACCTTCCGATCATCTCCGCTTTTCTTGCATTCGCCCTCGCT
CAGTTCCTCAAAGTCTTCACTAATTGGTACAAAGAAAAGAGATGGGACTCTAAAAAGATGATTAGTTCTGGTGGAATGCCTTCCTC
TCACTCTGCTACTGTCACTGCCTTAGCTCTTGCCATTGGCCTTGAGGAAGGTGCTGGATCACCCGCTTTTGCTATCGCTCTTGTCT
TAGCATGCGTTGTTGCAGGTAATGTATGATGCCTCTGGGGTCAGGCTTCATGCTGGTCGCCAAGCTGAGAGCATCCGTTATCCACA
GTTAAACCCTTGCGTGAACTGTTCGGCCACACTCCTATCCAGGTTGCAGCAGGTGCTGTTTTAGGATGCGTGGTAGCGTTTTTGAT
GAGGAGTACAAGGTAGTTTCTACACAACAAAGACTCCAAAATTCTTTTGAAAATCATAGACCCTTGAGAGAAACTTCATCAGCGAT
CAAGCTGAGGGTAGATTATTGGAAGTAAATGGAAAATTATTTCACATCTGTGCAATATATAGATCATAGTTTTAAGAGAATTGTCT
AAGTGAACTGACTTGTCATTGTTATGCTATTTTTCTCTTCATAATTATTCTTACCTTGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002885453 hypothetical protein ARALYDRAFT_898610 [Arabidopsis lyrata subsp. lyrata]4866e-047
NP_188798 Acid phosphatase/vanadium-dependent haloperoxidase-related protein [Arabidopsis thaliana]4769e-046
XP_002270664 PREDICTED: hypothetical protein [Vitis vinifera]4615e-044
BAB02356 unnamed protein product [Arabidopsis thaliana]4562e-043
XP_002529338 conserved hypothetical protein [Ricinus communis]3811e-034

Swiss-Prot top hits (Blast detail)Scoree value
O32107 Uncharacterized membrane protein yuiD1494e-009

TrEMBL top hits (Blast detail)Scoree value
Q8L7M6 Putative uncharacterized protein At3g216204767e-046
Q9LVE5 Gb|AAB61516.14561e-043
B9STL9 Putative uncharacterized protein3817e-035
B9I154 Predicted protein3638e-033
C6SZ64 Putative uncharacterized protein3565e-032

Arabidopsis top hits (Blast detail)Scoree value
AT3G21610.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 626 Blast hits to 626 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).6306e-066
AT3G21610.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 610 Blast hits to 610 proteins in 200 species: Archae - 0; Bacteria - 358; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).4012e-039
AT1G67600.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24350.1); Has 627 Blast hits to 627 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).2856e-026
AT1G24350.1 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 626 Blast hits to 626 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).2784e-025
AT1G24350.2 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 622 Blast hits to 622 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).2784e-025

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  100%

Unigene MembersMember information