Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN32117

FASTA Sequence
Unigene ID: UN32117Length: 352 SSR 
ATTAAAGTTGCAGATTGATTAAAGATTTAGTGTTATAAATCAGAGAGAGAGAGTCAAGACTAGGAGTAATGAAACTGGTAGCAACA
ACTCAAAACTGATAACATTAAAACCAACTTAATGTTAAAACACAAACATGTATATATGTGGTAGGCTGAGACCAGTATATTGGAGT
ATCTAGTTCCTTCTAATGGTCTTTGACGGAACAAGTATTCCTCGCTTCTCCAAGCTCTTGAATCGATCTCTTGCTAGCGTGCAACA
TGCTATATATTATAGTTTGCACGAACACAAGTTAATAAAACGTTCTCTTTGTTTTATTAATCTTCCTTTGCTTTCTTACACTTTTC
TTTCTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565931 uncharacterized protein [Arabidopsis thaliana]1322e-006
AAM64972 unknown [Arabidopsis thaliana]1322e-006
NP_001078030 uncharacterized protein [Arabidopsis thaliana]1322e-006
BAH19427 AT2G40430 [Arabidopsis thaliana]1322e-006
XP_002881721 hypothetical protein ARALYDRAFT_903334 [Arabidopsis lyrata subsp. lyrata]1322e-006

Swiss-Prot top hits (Blast detail)Scoree value
O22892 Uncharacterized protein At2g404301327e-008

TrEMBL top hits (Blast detail)Scoree value
B9DFB0 AT2G40430 protein (Fragment)1321e-006
Q8LB48 Putative uncharacterized protein1321e-006

Arabidopsis top hits (Blast detail)Scoree value
AT2G40430.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tumor suppressor protein Gltscr2 (InterPro:IPR011211), P60-like (InterPro:IPR011687); Has 601 Blast hits to 544 proteins in 148 species: Archae - 0; Bacteria - 22; Metazoa - 201; Fungi - 103; Plants - 32; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink).1325e-009
AT2G40430.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tumor suppressor protein Gltscr2 (InterPro:IPR011211), P60-like (InterPro:IPR011687); Has 608 Blast hits to 551 proteins in 148 species: Archae - 0; Bacteria - 22; Metazoa - 203; Fungi - 106; Plants - 34; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink).1325e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  100%

Unigene MembersMember information