Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN32132

FASTA Sequence
Unigene ID: UN32132Length: 479 SSR 
CAGTACTTGATTTATAAACATCTTGTAATGTACTGAGTACTGCAACATGAAACATGAGTTTACAAAGCTAAACATTAATCATTTAT
TTGTTTCCAGATTTCCTTGAATTAGAATAAGAAAGAAAAACACAATATATGGCATCTTAATCAAATCTTTTAGTCTTTTAAAACCA
TCGTAACGGCACTTTTGGGTGAAGCACTTTTGTTAGGGCCTTTCGGTGCAGCTGCTGGAGAAACCGAACCAGCACCACTTGTGTCA
GAGAACGAAGAGAATTTTGGAGCATCTGAGCCGCTAGGGGTGGTGGTGGTGGTTGCAGCATTCGGGTCAGCAGCCAAGGGACCAGG
AGTGTACGGTACACCTTTCCCTGGAATCCAAACATCACCTTGGATGTACATACCCGGTGTGAAACTGAGAATCTCTTCGTCGCTCA
GTAACTTGATCCCAGGCCAAGTAACCCGGTTTGCAAGGCCTGCTCCGGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884519 pectinesterase family protein [Arabidopsis lyrata subsp. lyrata]3373e-030
BAC42986 putative pectinesterase [Arabidopsis thaliana]3122e-027
NP_187212 pectinesterase 21 [Arabidopsis thaliana]3122e-027
XP_002872255 pectinesterase family protein [Arabidopsis lyrata subsp. lyrata]2315e-018
NP_198139 pectinesterase 28 [Arabidopsis thaliana]2191e-016

Swiss-Prot top hits (Blast detail)Scoree value
Q8GX86 Probable pectinesterase/pectinesterase inhibitor 213122e-028
Q3E8Z8 Putative pectinesterase/pectinesterase inhibitor 282191e-017
Q9FJ21 Probable pectinesterase/pectinesterase inhibitor 581275e-007
Q84R10 Probable pectinesterase/pectinesterase inhibitor 361212e-006
Q8GXA1 Probable pectinesterase/pectinesterase inhibitor 231194e-006

TrEMBL top hits (Blast detail)Scoree value
Q8VY44 Pectin methylesterase (Fragment)1311e-006
B9HXR2 Pectinesterase1302e-006
B9RT91 Pectinesterase1302e-006
B9RFE0 Pectinesterase1292e-006
B9N4L4 Pectinesterase1257e-006

Arabidopsis top hits (Blast detail)Scoree value
AT3G05610.1 pectinesterase family protein3122e-029
AT5G27870.1 pectinesterase family protein2191e-018
AT5G49180.1 pectinesterase family protein1275e-008
AT3G60730.1 pectinesterase family protein1259e-008
AT3G06830.1 pectinesterase family protein1195e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  100%

Unigene MembersMember information