 |
Information for unigene UN37498
| FASTA Sequence |
| Unigene ID: UN37498 | Length: 558 |
SSR | | ATATATACGTCACAAAGAAAGCTTTAACAACTACACACTATATCTAAGTTATCTTCTATTGTGATTCTCATGTTTCTCCTCTCTCT
TTTTTAATTTTATTGAAAATACCAAATATTTGATTAGAAGATAAGGAGGTAATAAATAGTAAATGGCTGATCAAAATCCAAGAATC
ATCGTCGAGAAAAATCCATCTCAAGATCGTCTTGATGAACTGAAGATCAAGTCATGGCCCAAGTGGGGATGTTCACCAGGGAAGTA
CCATTTGAAATACGAAGCAGAAGAGATATGTTACATTGTGAAGGGTAAAGTTAAGGTTTACCCTAAATCATCATCATCATCAACAG
CAGCATCATCGTCATTGGATACAGGATTAGAGTGGTGTGTAGAGTTTGGAGCAGGTGATATCGTCACTTTTCCCAAGGAATTTTCT
TGTACTTTGGGATGTATCTCTTTCCGTTGACAAACATTACATATTTCCGCCCCAATTAGTTCTTCACTTCTTTGTTTTGATTTGTT
ACCATTGTTGTATTTTATGTTCATTTTGTTTTGGGGTTTTAC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| XP_002869482 hypothetical protein ARALYDRAFT_491890 [Arabidopsis lyrata subsp. lyrata] | 427 | 2e-040 |
| NP_567815 cupin domain-containing protein [Arabidopsis thaliana] | 410 | 2e-038 |
| XP_002268868 PREDICTED: similar to Os04g0509400 [Vitis vinifera] | 263 | 2e-021 |
| XP_002533628 conserved hypothetical protein [Ricinus communis] | 248 | 1e-019 |
| XP_002303103 predicted protein [Populus trichocarpa] | 246 | 2e-019 |
| Swiss-Prot top hits | Score | e value |
|---|
| No hits found | | |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| Q8LAH4 Putative uncharacterized protein | 410 | 1e-038 |
| B9T5V9 Putative uncharacterized protein | 248 | 9e-020 |
| B9GRB2 Predicted protein | 246 | 2e-019 |
| C6T203 Putative uncharacterized protein | 234 | 4e-018 |
| Q9M8Y6 At3g04300 | 206 | 7e-015 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT4G28703.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 311 Blast hits to 311 proteins in 80 species: Archae - 0; Bacteria - 147; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). | 410 | 1e-040 |
| AT3G04300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10300.1); Has 364 Blast hits to 364 proteins in 91 species: Archae - 0; Bacteria - 191; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). | 206 | 5e-017 |
| AT4G10300.1 FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Protein of unknown function DUF861, cupin-3 (InterPro:IPR008579), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04300.1); Has 356 Blast hits to 356 proteins in 93 species: Archae - 0; Bacteria - 181; Metazoa - 0; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). | 184 | 2e-014 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|
