Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN39936

FASTA Sequence
Unigene ID: UN39936Length: 823 SSR 
GTTGTGAAGAAACAAAAGAGGCAAAAAAAAAAAGAACAGAGAAAAGATTCAATGTCTGTAACAGCAGCAACTCACATGAACACGAT
CAACCATTTGTCGTCGACAACCTGTAAAACCTCCAATCTCATCTGCTCCAATCACAGATTGGCTCCTCAACCTTTTCATCGTAAAC
CCAAATCGTTTCCTCAGTTGCTTCCCCTAAATGGCTCCTCCTCCTCCTCCTCTCGCTCTCCTTCGTCTTCCGTCACTCGAAGATCG
AGATTCAACACTCGCAACAAACCCTTCTCTGTTTCCATGGAGTGGCAAGACTGCACAGTGAAGATGGAAGTAGATATACCAGTGTC
AGTAGCGTATAACTTCTACTTGGATCGTGAATCTTTCCCCAAGTGGATGCCTTTCATTTCATCCGTTGAGGTGTTAAAGGACAAGC
CTGATCTATCACGTTGGTCACTCAAGTACAATGCTTTTGGCCAAGACATCAAGTATTCTTGGCTTGCTCGCAATCTTCAGCCTACT
CCTAATCAGAAAATCCATTGGAGATCTCTTGAAGGTCTTCCTAATAAAGGCAGCGTTAGGTTCTTCCCTAAAGGTCCTTCATCTTG
CCTCGTTGAGCTAACTGTATCATATGAAGTCCCTGCGCTTTTGACCCCTGTGGCATCGGCGCTCCGGCCCTTTTTAGAAAGCTTGC
TTAGAGGTGGACTTGAAAGATTTGCAACCTTGGCTAAAACCACTTGAAAGAAAGAAAAAAAAGGATCTCTGTGTGTATGCATCTCT
GTGATCTGGACTTTAGATATATCTTTCGTATACAATGGTCTGGACTCGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_563656 SRPBCC ligand-binding domain-containing protein [Arabidopsis thaliana]8684e-091
XP_002892111 hypothetical protein ARALYDRAFT_311357 [Arabidopsis lyrata subsp. lyrata]7941e-082
XP_002302795 predicted protein [Populus trichocarpa]6732e-068
XP_002515216 conserved hypothetical protein [Ricinus communis]6678e-068
ACJ84143 unknown [Medicago truncatula]6661e-067

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q94K52 Putative uncharacterized protein At1g024758683e-091
B9GSY3 Predicted protein6731e-068
B9RN77 Putative uncharacterized protein6675e-068
B7FHB4 Putative uncharacterized protein6667e-068
B9I9D9 Predicted protein6595e-067

Arabidopsis top hits (Blast detail)Scoree value
AT1G02475.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01883.1); Has 350 Blast hits to 350 proteins in 105 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).8691e-093
AT4G01883.1 LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02475.1); Has 320 Blast hits to 320 proteins in 96 species: Archae - 0; Bacteria - 186; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).5912e-061
AT1G02470.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02475.1); Has 276 Blast hits to 276 proteins in 86 species: Archae - 0; Bacteria - 162; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).5706e-059
AT1G02470.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02475.1); Has 273 Blast hits to 273 proteins in 85 species: Archae - 0; Bacteria - 160; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).5581e-057

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  33%
 
121  33%
 
91  33%

Unigene MembersMember information