Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN39978

FASTA Sequence
Unigene ID: UN39978Length: 716  SNP
TTTTTTTTACAAAAACAATGGCGGCTCAGATCATAATTTCCTCTTTCCTTTTCTTATTCTTCTCTGTCTCCGTCTCTGCTCTTAAC
GTCGGTGTTCAGCTCACACATCCCACCGTTTCTCTGAGCAAAGAATGTAGCCGGAAATGCGAATCAGAGTTCTGTTCAGTGCCTCC
ACTTTTGAGGTATGGGAAGTACTGTGGACTATTGTACAGTGGATGTCCTGGAGAGAGACCTTGTGATGGTCTTGATTCATGTTGCA
TGAAGCATGATGCTTGTGTTCAATCCAAAAATAATGATTACCTAAGCCAAGAGTGTAGTCAGAAGTTCATAAACTGCATGGACAAT
TTCAGCAATACGAAGCAACCGACGTTTACAGGTAACACATGCGATCCCGATGAAGTCATTGATGTCATCTCCATTGTCATGGACGC
CGCCCTTATCGCCGGCAGAGTCTTCCGCAAACCCTGAATATGTTTTTGTATTGGTTAATCGTTTCTCTTGTTTCTTAAGTACTCTC
ACACATTTGTCTTTTGTTTTATCTAATGTCTTCATTTATATCATCTGTTTTACTGGAAAACACACTAATATTACGAATTGTATTAC
TATATAGCTTTATGTGTCTCGGATTCTAAGGGCCGCACTAAGGCCATGTTAGAGAACTAGTGTATATGTACTTGATCAGGAATATG
GTCACGAGGAAATAAATTGTCGTTTTGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002883742 phospholipase A2-alpha [Arabidopsis lyrata subsp. lyrata]6944e-071
NP_565337 Phospholipase A2-like protein [Arabidopsis thaliana]6936e-071
ABK93646 unknown [Populus trichocarpa]5961e-059
XP_002325228 predicted protein [Populus trichocarpa]5914e-059
ACU15282 unknown [Glycine max]5871e-058

Swiss-Prot top hits (Blast detail)Scoree value
Q10E50 Phospholipase A2 homolog 34111e-039
Q9XG81 Probable phospholipase A2 homolog 23691e-034
Q9XG80 Probable phospholipase A2 homolog 11987e-015

TrEMBL top hits (Blast detail)Scoree value
Q8S8N6 Expressed protein6934e-071
A9PB93 Putative uncharacterized protein5967e-060
B9IN01 Predicted protein (Fragment)5913e-059
C6T165 Putative uncharacterized protein5878e-059
C6TCD8 Putative uncharacterized protein5851e-058

Arabidopsis top hits (Blast detail)Scoree value
AT2G06925.1 PLA2-ALPHA; phospholipase A26942e-073
AT4G29470.1 phospholipase A2, putative2103e-017
AT4G29460.1 phospholipase A2 gamma, secretory low molecular weight2022e-016
AT2G19690.1 PLA2-BETA (PHOSPHOLIPASE A2-BETA); calcium ion binding / phospholipase A22013e-016

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
84  15%
 
97  26%
 
112  7%
 
102  7%
 
123  11%
 
67  26%
 
72  7%

Unigene MembersMember information