Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN41875

FASTA Sequence
Unigene ID: UN41875Length: 442 SSR 
GGGCAGGCCTCCTTTGAGTGTCAGCTTCGTCTCGTGAACAAGATCTCTCTAAACCCTTCAACCTCGATTCGATTCGATTCGATTCG
ATTCGACTCAGCTACAGAAACCATCATGGGATTCTGGACACTGATGGAAGGACTGCTGCTATTCGCAAACGCGCTTGCTATCCTCA
ACGAAGACCGTTTCTTAGCTCCCAAAGGATGGACACTCGCAGAGCTTCACCAAACCGGCAAAAGAAACTCTCTCAAAGGCCAAATC
GTCGGTCTCATCCACGCCTGCCAGTACATGAGGCTTCCCCTCATGCTCTTCAACTTAATTGTCATCGTCTTTAAACTCTTCTCCGG
TTAACAAAAAAAACACAATTTCAAATACTTTCAATCCAAACACTTCTACAACTTTATTGTTGATTCATCCATGTTCATTTTATAAT
GAATTTCAAATT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565877 Yos1-like protein [Arabidopsis thaliana]3982e-037
BAD94948 hypothetical protein [Arabidopsis thaliana]3947e-037
NP_001078282 Yos1-like protein [Arabidopsis thaliana]3401e-030
ABK28039 unknown [Arabidopsis thaliana]3401e-030
XP_002527879 conserved hypothetical protein [Ricinus communis]3265e-029

Swiss-Prot top hits (Blast detail)Scoree value
O13825 Protein transport protein yos11257e-007

TrEMBL top hits (Blast detail)Scoree value
Q8LG42 At2g379753982e-037
Q570V4 Putative uncharacterized protein At2g379753945e-037
A0MDR4 Putative uncharacterized protein (Fragment)3408e-031
Q8GRX8 At3g540823408e-031
B9SPG0 Putative uncharacterized protein3264e-029

Arabidopsis top hits (Blast detail)Scoree value
AT2G37975.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yos1-like (InterPro:IPR013880); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54085.2); Has 146 Blast hits to 146 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 25; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).3991e-039
AT3G54085.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Yos1-like (InterPro:IPR013880); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37975.1); Has 139 Blast hits to 139 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 86; Fungi - 16; Plants - 26; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).3417e-033
AT3G54085.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Yos1-like (InterPro:IPR013880); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37975.1).3417e-033

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  67%
 
61  33%

Unigene MembersMember information