Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN41947

FASTA Sequence
Unigene ID: UN41947Length: 894 SSR 
GTCATCGATCAAGATCATCATCATCAGATTCCCCAGAAAGGAGTAGGGAAGAAGAACAGGAAGAATCAGAAGAACAACAACAACAA
CAACAAGGAAGATGAGAAGAACACCAACAACGAGAAGAGGTTTAAGACTCTTCCTCCCGCGGAGGCACTTCCGAGGAACGAGACCA
TCGGTGGTTACATCTTCGTGTGCAACAACGACACCATGGAGGAGAATCTGAAGCGCCAGCTTTTCGGTTTGCCTCCGAGATACAGG
GACTCGGTTGGAGCCATCACTCCCGGTCTTCCTCTCTTCCTCTACAACTACTCCACTCACCAGCTCCACGGTGTTTACCAGGCCGC
TAGCTTCGGTGGGACTAACATTGAGCTCAACGCTTTGGAAGACAAGAAATGTCCTGGCGAATCTCGGTTCCCTGCTCAGGTCAGGG
CCATCACCAGGAAAGTTTGTTTGCCTTTGGAAGAAGATTCTTTCCGTCCTATTCTCCATCACTACGACGGCCCTAAGTTCCGCCTC
GAACTCACCGTCCCTGAGGTTCTTTCTCTTTTGGACATTTTTGATGAGCAAAACCCTTGAGTTCGTTTGGGTTGGGATTTAAAGAA
AACAACAACAACAATACGAAGACACAGACTAAAAGTTCCCTTTTACCATATCCATAAAGAGAGAGATATTTACATATCATCATCCT
ACGTATATTATTAGTAATTGTCTCAAGAAAATGGTACTAGTTTATATACTTTTCGGGTTTATTTTCTTTAATATTTTTACAAGAGG
GGATGTTTTAAATTAGATATGAGATGGGGCTACATTTGCGTGGGTGAGATGAACAAAAAACAAATCATGTCTTTCACTTGTGTTTG
TGTAAAGTAAATAAAGTTTCATGTGTTACACCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAB08438 unnamed protein product [Arabidopsis thaliana]8802e-092
NP_568600 DCD (Development and Cell Death) domain protein [Arabidopsis thaliana]8802e-092
XP_002870594 hypothetical protein ARALYDRAFT_493778 [Arabidopsis lyrata subsp. lyrata]8749e-092
XP_002266388 PREDICTED: similar to B2 protein [Vitis vinifera]7905e-082
XP_002518847 n-rich protein, putative [Ricinus communis]7807e-081

Swiss-Prot top hits (Blast detail)Scoree value
P37707 B2 protein7401e-077

TrEMBL top hits (Blast detail)Scoree value
Q8RXN8 Putative uncharacterized protein8801e-092
Q9FHX9 Genomic DNA, chromosome 5, P1 clone:MJC208801e-092
B9RYM8 N-rich protein, putative7805e-081
C6TAQ0 Putative uncharacterized protein7563e-078
Q5JZR1 N-rich protein7431e-076

Arabidopsis top hits (Blast detail)Scoree value
AT5G42050.1 FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27090.1); Has 5084 Blast hits to 2870 proteins in 85 species: Archae - 0; Bacteria - 24; Metazoa - 270; Fungi - 58; Plants - 157; Viruses - 8; Other Eukaryotes - 4567 (source: NCBI BLink).8816e-095
AT3G27090.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42050.1); Has 642 Blast hits to 564 proteins in 35 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 473 (source: NCBI BLink).6754e-071
AT5G61910.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32910.1); Has 4051 Blast hits to 2453 proteins in 312 species: Archae - 1; Bacteria - 477; Metazoa - 1792; Fungi - 482; Plants - 477; Viruses - 8; Other Eukaryotes - 814 (source: NCBI BLink).2321e-019
AT5G61910.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32910.1); Has 4051 Blast hits to 2453 proteins in 312 species: Archae - 1; Bacteria - 477; Metazoa - 1792; Fungi - 482; Plants - 477; Viruses - 8; Other Eukaryotes - 814 (source: NCBI BLink).2321e-019
AT5G61910.3 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32910.1); Has 4051 Blast hits to 2448 proteins in 312 species: Archae - 1; Bacteria - 479; Metazoa - 1786; Fungi - 481; Plants - 479; Viruses - 8; Other Eukaryotes - 817 (source: NCBI BLink).2321e-019

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
73  100%

Unigene MembersMember information