Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN42450

FASTA Sequence
Unigene ID: UN42450Length: 315 SSR 
GTGAGAACACTTGCTCCGATTGTTTCTCGGGTCGGGTCATGGATGGAAGGATCAAGAACTCGGTTCGAGCTAGAATTGTCAACGTG
GGCCACGAAACCAGCAATGCCTTGCCCTTGATTAATGCATTTGCTAAAAAGTATTAATTTAAAACTAGTTTTAAGAAATATTTTGT
GGCATCTCATATATAAATAATATATATAATGGTCTCCGTAAATGTAATATATATATATGTCGAGTTGGTTAGATTTTTTTATGTGG
TTTGTACTATTGTTCATTTGTATTTTGAGATATTAAAGTTTAAGAAAGAAGTTGAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_201041 invertase/pectin methylesterase inhibitor family protein / DC 1.2-like protein [Arabidopsis thaliana]2111e-015
BAB17684 DC 1.2 homolog [Arabidopsis thaliana]2111e-015
AAM67138 ripening-related protein-like [Arabidopsis thaliana]2111e-015
XP_002864786 hypothetical protein ARALYDRAFT_496412 [Arabidopsis lyrata subsp. lyrata]2111e-015
XP_002875836 invertase/pectin methylesterase inhibitor family protein [Arabidopsis lyrata subsp. lyrata]1941e-013

Swiss-Prot top hits (Blast detail)Scoree value
P17407 21 kDa protein1353e-008

TrEMBL top hits (Blast detail)Scoree value
Q8L8T0 Ripening-related protein-like2119e-016
Q9FXM2 DC 1.2 homolog (Fragment)2119e-016
Q9LVA4 Ripening-related protein-like2119e-016
Q9STY5 Putative uncharacterized protein T21L8.1301903e-013
A9PDL3 Predicted protein1463e-008

Arabidopsis top hits (Blast detail)Scoree value
AT5G62350.1 invertase/pectin methylesterase inhibitor family protein / DC 1.2 homolog (FL5-2I22)2123e-018
AT3G47380.1 invertase/pectin methylesterase inhibitor family protein1918e-016
AT4G12390.1 PME1 (PECTIN METHYLESTERASE INHIBITOR 1); enzyme inhibitor/ pectinesterase/ pectinesterase inhibitor1317e-009
AT4G25260.1 invertase/pectin methylesterase inhibitor family protein1236e-008
AT5G62360.1 invertase/pectin methylesterase inhibitor family protein1236e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  100%

Unigene MembersMember information