Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN42716

FASTA Sequence
Unigene ID: UN42716Length: 470 SSR 
GGGCTGCCCATTTCGTTCGTCGTCGTACATCTCTCTCTCTCTCTCTCGCTCTCCTCGCTCATCTACTCAGAGAATTTGTGCAAGGT
TGGAAAATGGCAGGACTCAAGGTTGCGCATGCCACACTTAAAGGCCCGAGTGTGGTGAAGGAATTAGTTATCGGTTTGGCGCTGGG
TTTAGCTGCTGGTGGTCTCTGGAAAATGCACCACTGGAACGAGCAGAGGAAAACCAGAACTTTCTACGACTTGCTCGAGAGAGGCG
AGATCAGCGTTGTCCACCCTGCTGAAGAGTGAAATTCAACACTATGCCAAACCACTCTCTCAACCTCTATTTTTATGTTATTATTA
TTGTTTCTTGACTTCTTAGACAAAAGTTAAGAAAGTGTTGATTGCAGAAGAAATAAACAACAAATCGGATATCTTTTGTTAAATTT
CAGAACATCTTTCTTGATTTTATTTGAATGTTTTTGGGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3042e-026
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana]2997e-026
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]2997e-026
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-22952e-025
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata]2933e-025

Swiss-Prot top hits (Blast detail)Scoree value
O22912 Probable cytochrome c oxidase subunit 5C-12995e-027
Q9LZQ0 Cytochrome c oxidase subunit 5C-22952e-026
Q9FLK2 Probable cytochrome c oxidase subunit 5C-32898e-026
Q9SXX7 Cytochrome c oxidase subunit 5C2711e-023
Q42841 Cytochrome c oxidase subunit 5C2701e-023

TrEMBL top hits (Blast detail)Scoree value
Q2HIR0 At5g613102897e-025
A1YMW4 Cytochrome-c oxidase2842e-024
D6BR49 Cytochrome c oxidase polypeptide Vc2799e-024
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative2762e-023
C6T2P2 Putative uncharacterized protein2753e-023

Arabidopsis top hits (Blast detail)Scoree value
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein2996e-028
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative2899e-027
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative2899e-027
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative2899e-027
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative2899e-027

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  67%
 
201  33%

Unigene MembersMember information