Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN42785

FASTA Sequence
Unigene ID: UN42785Length: 307 SSR 
GCGATGAAATGGAATGTAAGAATGACACATTCCAAAGATGGAGAAGGAGTGCTCTCTGTTCAGAAGTCAGTGTGGCGTCCTACAGA
GGTCGAGGCAATTACATCGGCAATAGTTTAAGAGGTGAAGGAAACAAAGAAAAAGAAGAAGAAGAAGAAGACATGTTGGTTTTTAA
TTTTATTATAGTTGTATGATTAAAGTTGTTTCTTTTATGATCACATTGATTGGTCCAATACTTGTATCCTTTTTCCTTTGCATCGA
CAAAAATTGTATGCAAGACAATTATCTCAAAACTTTAAACTTATGAGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAG51752 unknown protein; 55790-52851 [Arabidopsis thaliana]1644e-010
NP_174240 putative methyltransferase PMT24 [Arabidopsis thaliana]1644e-010
BAE99079 hypothetical protein [Arabidopsis thaliana]1644e-010
XP_002893569 hypothetical protein ARALYDRAFT_473159 [Arabidopsis lyrata subsp. lyrata]1644e-010
NP_201208 putative methyltransferase PMT26 [Arabidopsis thaliana]1474e-008

Swiss-Prot top hits (Blast detail)Scoree value
Q6NPR7 Probable methyltransferase PMT241641e-011
Q8L7V3 Probable methyltransferase PMT261471e-009

TrEMBL top hits (Blast detail)Scoree value
A9PEP0 Putative uncharacterized protein1383e-007
B9GTY2 Predicted protein1383e-007
B9H7K6 Predicted protein1302e-006
B9H4A8 Predicted protein1267e-006
B9HEX5 Predicted protein1267e-006

Arabidopsis top hits (Blast detail)Scoree value
AT1G29470.1 dehydration-responsive protein-related1658e-013
AT1G29470.2 dehydration-responsive protein-related1658e-013
AT5G64030.1 dehydration-responsive protein-related1471e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  100%

Unigene MembersMember information