![](/radish/img/header.png) |
Information for unigene UN44529
FASTA Sequence |
Unigene ID: UN44529 | Length: 465 |
SSR | | GGCCATTTCGTTGGTCGTCGTACATCTCTCTCTCTCTCTCTCTCTCCAGCTCTCCTCGCTCATCTAGTCAGAGAATTTGTGCAGGG
TTGAAAATGGCAGGACACAAGGTTGTGCATGCCACACTTAAAGGCCCGAGTGTAGTGAAGGAATTAGTTATCGGTCTGGCGCTGGG
TTTAGCTGCTGGTGGTCTCTGGAAGATGCACCACTGGAACGAGCAGAGGAAAACCAGAGCTTTCTATGACTTGCTCGAGAGAGGCG
AGATCAGCGTTGTCCACCCTGAAGAGTGAAATTCAACACTATGCCAAACCATTCTCTCAAGCTCTATTTTTATGTTATTATTATTG
TTTCTTGACTTCTTAGACAAAAGTTAAGAAAGTGTTGATTGCAGAAGAAATAAACAACAAATCGGATATCTTTTGTTAAATTTCAG
AACATCCTTCTTGATTTTATTTGAATGTTTTTGGC
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata] | 312 | 2e-027 |
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata] | 310 | 4e-027 |
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana] | 307 | 8e-027 |
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata] | 307 | 8e-027 |
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-2 | 303 | 2e-026 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O22912 Probable cytochrome c oxidase subunit 5C-1 | 307 | 6e-028 |
Q9LZQ0 Cytochrome c oxidase subunit 5C-2 | 303 | 2e-027 |
Q9FLK2 Probable cytochrome c oxidase subunit 5C-3 | 302 | 2e-027 |
Q8VY39 Cytochrome c oxidase subunit 5C-2 | 276 | 2e-024 |
Q9SXX7 Cytochrome c oxidase subunit 5C | 270 | 1e-023 |
TrEMBL top hits (Blast detail) | Score | e value |
Q2HIR0 At5g61310 | 302 | 2e-026 |
A1YMW4 Cytochrome-c oxidase | 296 | 1e-025 |
D6BR49 Cytochrome c oxidase polypeptide Vc | 282 | 4e-024 |
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative | 280 | 7e-024 |
C6T2P2 Putative uncharacterized protein | 271 | 8e-023 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein | 308 | 5e-029 |
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 303 | 2e-028 |
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 303 | 2e-028 |
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 303 | 2e-028 |
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 303 | 2e-028 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|