Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN44529

FASTA Sequence
Unigene ID: UN44529Length: 465 SSR 
GGCCATTTCGTTGGTCGTCGTACATCTCTCTCTCTCTCTCTCTCTCCAGCTCTCCTCGCTCATCTAGTCAGAGAATTTGTGCAGGG
TTGAAAATGGCAGGACACAAGGTTGTGCATGCCACACTTAAAGGCCCGAGTGTAGTGAAGGAATTAGTTATCGGTCTGGCGCTGGG
TTTAGCTGCTGGTGGTCTCTGGAAGATGCACCACTGGAACGAGCAGAGGAAAACCAGAGCTTTCTATGACTTGCTCGAGAGAGGCG
AGATCAGCGTTGTCCACCCTGAAGAGTGAAATTCAACACTATGCCAAACCATTCTCTCAAGCTCTATTTTTATGTTATTATTATTG
TTTCTTGACTTCTTAGACAAAAGTTAAGAAAGTGTTGATTGCAGAAGAAATAAACAACAAATCGGATATCTTTTGTTAAATTTCAG
AACATCCTTCTTGATTTTATTTGAATGTTTTTGGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3122e-027
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata]3104e-027
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana]3078e-027
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3078e-027
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-23032e-026

Swiss-Prot top hits (Blast detail)Scoree value
O22912 Probable cytochrome c oxidase subunit 5C-13076e-028
Q9LZQ0 Cytochrome c oxidase subunit 5C-23032e-027
Q9FLK2 Probable cytochrome c oxidase subunit 5C-33022e-027
Q8VY39 Cytochrome c oxidase subunit 5C-22762e-024
Q9SXX7 Cytochrome c oxidase subunit 5C2701e-023

TrEMBL top hits (Blast detail)Scoree value
Q2HIR0 At5g613103022e-026
A1YMW4 Cytochrome-c oxidase2961e-025
D6BR49 Cytochrome c oxidase polypeptide Vc2824e-024
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative2807e-024
C6T2P2 Putative uncharacterized protein2718e-023

Arabidopsis top hits (Blast detail)Scoree value
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein3085e-029
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative3032e-028
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative3032e-028
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative3032e-028
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative3032e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  100%

Software error:

can't close file: No space left on device at /var/www/cgi-bin/radish/EST/search.cgi line 576.

For help, please send mail to the webmaster (feibioinfolab@gmail.com), giving this error message and the time and date of the error.