|
Information for unigene UN45185
FASTA Sequence |
Unigene ID: UN45185 | Length: 373 |
SSR | | GATACAACATTGAACATATAATTAAAAGAAATACATACTTAAAAGAGTAATTTTTGTTTTTGTTTTGAGTAGGGTTGATCCTTAAA
AATACTAAAATCATCCGTACACAACAACATGAAAGGGAAACGACTAGTAGGAGAGTAGGTAGGGGTTAAAGAGCTGCCACAAGTTA
ACACCATAGAAGAGAGAGAGAGAGAGAGAGTCACAGTCACATTCACCATCACCTTTTTTGTCACTAGTGAAAGTAAGGAGGAGGAG
GAGGAGAATATACTGGCGTTGGTGGAGGTGGTGGGGATGGATAGTGATAAACCGGTGGTGGTGGTGAGTGCGGTGGTGGAGGTAAC
GAGTAATGTGGCGGCGGCGGTGGCGGTGC
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002515589 LRX1, putative [Ricinus communis] | 212 | 1e-015 |
NP_193070 leucine-rich repeat extensin-like protein 3 [Arabidopsis thaliana] | 187 | 8e-013 |
XP_002516600 serine-threonine protein kinase, plant-type, putative [Ricinus communis] | 169 | 9e-011 |
XP_002982842 hypothetical protein SELMODRAFT_422106 [Selaginella moellendorffii] | 168 | 1e-010 |
XP_001270276 actin associated protein Wsp1, putative [Aspergillus clavatus NRRL 1] | 167 | 2e-010 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q9T0K5 Leucine-rich repeat extensin-like protein 3 | 187 | 3e-014 |
O81765 Pollen-specific leucine-rich repeat extensin-like protein 4 | 174 | 9e-013 |
Q9LUI1 Leucine-rich repeat extensin-like protein 6 | 171 | 2e-012 |
Q9FLQ7 Formin-like protein 20 | 170 | 2e-012 |
Q9XIL9 Pollen-specific leucine-rich repeat extensin-like protein 3 | 164 | 1e-011 |
TrEMBL top hits (Blast detail) | Score | e value |
B9RPC0 LRX1, putative | 212 | 6e-016 |
Q76KW3 Hydroxyproline-rich glycoprotein-2 (Fragment) | 171 | 4e-011 |
B9RS81 Serine-threonine protein kinase, plant-type, putative | 169 | 6e-011 |
A1CMR3 Actin associated protein Wsp1, putative | 167 | 1e-010 |
Q8H9E1 Extensin (Fragment) | 165 | 2e-010 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT4G13340.1 leucine-rich repeat family protein / extensin family protein | 187 | 3e-015 |
AT3G22800.1 leucine-rich repeat family protein / extensin family protein | 177 | 5e-014 |
AT4G33970.1 protein binding / structural constituent of cell wall | 174 | 1e-013 |
AT1G49490.1 leucine-rich repeat family protein / extensin family protein | 167 | 7e-013 |
AT2G15880.1 leucine-rich repeat family protein / extensin family protein | 164 | 2e-012 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|