 |
Information for unigene UN45185
| FASTA Sequence |
| Unigene ID: UN45185 | Length: 373 |
SSR | | GATACAACATTGAACATATAATTAAAAGAAATACATACTTAAAAGAGTAATTTTTGTTTTTGTTTTGAGTAGGGTTGATCCTTAAA
AATACTAAAATCATCCGTACACAACAACATGAAAGGGAAACGACTAGTAGGAGAGTAGGTAGGGGTTAAAGAGCTGCCACAAGTTA
ACACCATAGAAGAGAGAGAGAGAGAGAGAGTCACAGTCACATTCACCATCACCTTTTTTGTCACTAGTGAAAGTAAGGAGGAGGAG
GAGGAGAATATACTGGCGTTGGTGGAGGTGGTGGGGATGGATAGTGATAAACCGGTGGTGGTGGTGAGTGCGGTGGTGGAGGTAAC
GAGTAATGTGGCGGCGGCGGTGGCGGTGC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
| XP_002515589 LRX1, putative [Ricinus communis] | 212 | 1e-015 |
| NP_193070 leucine-rich repeat extensin-like protein 3 [Arabidopsis thaliana] | 187 | 8e-013 |
| XP_002516600 serine-threonine protein kinase, plant-type, putative [Ricinus communis] | 169 | 9e-011 |
| XP_002982842 hypothetical protein SELMODRAFT_422106 [Selaginella moellendorffii] | 168 | 1e-010 |
| XP_001270276 actin associated protein Wsp1, putative [Aspergillus clavatus NRRL 1] | 167 | 2e-010 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
| Q9T0K5 Leucine-rich repeat extensin-like protein 3 | 187 | 3e-014 |
| O81765 Pollen-specific leucine-rich repeat extensin-like protein 4 | 174 | 9e-013 |
| Q9LUI1 Leucine-rich repeat extensin-like protein 6 | 171 | 2e-012 |
| Q9FLQ7 Formin-like protein 20 | 170 | 2e-012 |
| Q9XIL9 Pollen-specific leucine-rich repeat extensin-like protein 3 | 164 | 1e-011 |
| TrEMBL top hits (Blast detail) | Score | e value |
| B9RPC0 LRX1, putative | 212 | 6e-016 |
| Q76KW3 Hydroxyproline-rich glycoprotein-2 (Fragment) | 171 | 4e-011 |
| B9RS81 Serine-threonine protein kinase, plant-type, putative | 169 | 6e-011 |
| A1CMR3 Actin associated protein Wsp1, putative | 167 | 1e-010 |
| Q8H9E1 Extensin (Fragment) | 165 | 2e-010 |
| Arabidopsis top hits (Blast detail) | Score | e value |
| AT4G13340.1 leucine-rich repeat family protein / extensin family protein | 187 | 3e-015 |
| AT3G22800.1 leucine-rich repeat family protein / extensin family protein | 177 | 5e-014 |
| AT4G33970.1 protein binding / structural constituent of cell wall | 174 | 1e-013 |
| AT1G49490.1 leucine-rich repeat family protein / extensin family protein | 167 | 7e-013 |
| AT2G15880.1 leucine-rich repeat family protein / extensin family protein | 164 | 2e-012 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|