Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN45185

FASTA Sequence
Unigene ID: UN45185Length: 373 SSR 
GATACAACATTGAACATATAATTAAAAGAAATACATACTTAAAAGAGTAATTTTTGTTTTTGTTTTGAGTAGGGTTGATCCTTAAA
AATACTAAAATCATCCGTACACAACAACATGAAAGGGAAACGACTAGTAGGAGAGTAGGTAGGGGTTAAAGAGCTGCCACAAGTTA
ACACCATAGAAGAGAGAGAGAGAGAGAGAGTCACAGTCACATTCACCATCACCTTTTTTGTCACTAGTGAAAGTAAGGAGGAGGAG
GAGGAGAATATACTGGCGTTGGTGGAGGTGGTGGGGATGGATAGTGATAAACCGGTGGTGGTGGTGAGTGCGGTGGTGGAGGTAAC
GAGTAATGTGGCGGCGGCGGTGGCGGTGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002515589 LRX1, putative [Ricinus communis]2121e-015
NP_193070 leucine-rich repeat extensin-like protein 3 [Arabidopsis thaliana]1878e-013
XP_002516600 serine-threonine protein kinase, plant-type, putative [Ricinus communis]1699e-011
XP_002982842 hypothetical protein SELMODRAFT_422106 [Selaginella moellendorffii]1681e-010
XP_001270276 actin associated protein Wsp1, putative [Aspergillus clavatus NRRL 1]1672e-010

Swiss-Prot top hits (Blast detail)Scoree value
Q9T0K5 Leucine-rich repeat extensin-like protein 31873e-014
O81765 Pollen-specific leucine-rich repeat extensin-like protein 41749e-013
Q9LUI1 Leucine-rich repeat extensin-like protein 61712e-012
Q9FLQ7 Formin-like protein 201702e-012
Q9XIL9 Pollen-specific leucine-rich repeat extensin-like protein 31641e-011

TrEMBL top hits (Blast detail)Scoree value
B9RPC0 LRX1, putative2126e-016
Q76KW3 Hydroxyproline-rich glycoprotein-2 (Fragment)1714e-011
B9RS81 Serine-threonine protein kinase, plant-type, putative1696e-011
A1CMR3 Actin associated protein Wsp1, putative1671e-010
Q8H9E1 Extensin (Fragment)1652e-010

Arabidopsis top hits (Blast detail)Scoree value
AT4G13340.1 leucine-rich repeat family protein / extensin family protein1873e-015
AT3G22800.1 leucine-rich repeat family protein / extensin family protein1775e-014
AT4G33970.1 protein binding / structural constituent of cell wall1741e-013
AT1G49490.1 leucine-rich repeat family protein / extensin family protein1677e-013
AT2G15880.1 leucine-rich repeat family protein / extensin family protein1642e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  100%

Unigene MembersMember information