|
Information for unigene UN48312
FASTA Sequence |
Unigene ID: UN48312 | Length: 536 |
SSR | | AGTGAACCAAGACAATGCATAACATCAAAGTAGTCAGATTATCACTCATTCACTCGCATGTTTTTTTCTCCAACCAAGGATGATAA
CATGAACACAAAGTTATTAGAGGTTGTGGTTCACAAACCCATGTTTACAAGAAACATAATAGCTAACAACAAACCAATGTTTGTAG
CGCAGCACAATTCAGATTCACTTAGCAAGCAGGTTTTGAGCTTGGTTCTCCTGCTGCTGCTGCTGGTAATTGAGAGTCCTCCTGAA
CAGCATGATGTGTGGCTCTGGACGATGGATCGAGTAATGAACCCATCCACGGCTCTGCTGGACACCAATCGCACGCCACTCATTTT
CGGAGAGAAGACGATTCTTGGGAAGAAGATTAGCGACTTCAGGAGGAAGCACGACGTGCCTGTACTCGAAAGTATCGTCGAAGTAT
TTGTCAGAGTACTGGATCTGGCCCATCTCGAAACCCTAGCTAGCTATGAAACGGAGAAAAGGGGGAAAATGAGAAGATTCATATTG
ATCGATCGTTTGAGAAATCC
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002879125 cdk-subunit 1 [Arabidopsis lyrata subsp. lyrata] | 426 | 3e-040 |
NP_180363 cyclin-dependent kinases regulatory subunit 1 [Arabidopsis thaliana] | 425 | 3e-040 |
BAF36296 hypothetical protein [Ipomoea trifida] | 425 | 3e-040 |
XP_002523737 Cyclin-dependent kinases regulatory subunit, putative [Ricinus communis] | 421 | 1e-039 |
AAS79576 putative CDK regulatory subunit [Ipomoea trifida] | 420 | 1e-039 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O23249 Cyclin-dependent kinases regulatory subunit 1 | 430 | 5e-042 |
A2XCH8 Cyclin-dependent kinases regulatory subunit 1 | 396 | 4e-038 |
Q6PS57 Cyclin-dependent kinases regulatory subunit 1 | 396 | 4e-038 |
Q9SJJ5 Cyclin-dependent kinases regulatory subunit 2 | 396 | 4e-038 |
P55933 Probable cyclin-dependent kinases regulatory subunit | 306 | 1e-027 |
TrEMBL top hits (Blast detail) | Score | e value |
A0A8Z1 Putative uncharacterized protein | 425 | 2e-040 |
B9SCL8 Cyclin-dependent kinases regulatory subunit, putative | 421 | 7e-040 |
Q6JJ57 Putative CDK regulatory subunit | 420 | 9e-040 |
Q6T300 Cyclin-dependent kinases regulatory subunit | 415 | 3e-039 |
A5AEC1 Putative uncharacterized protein | 412 | 8e-039 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT2G27960.1 CKS1 (CYCLIN-DEPENDENT KINASE-SUBUNIT 1); cyclin-dependent protein kinase/ protein binding | 431 | 4e-043 |
AT2G27970.1 CKS2 (CDK-subunit 2); cyclin-dependent protein kinase/ cyclin-dependent protein kinase regulator | 396 | 4e-039 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|