Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN48533

FASTA Sequence
Unigene ID: UN48533Length: 465 SSR 
CGCGGAGAGGTTATACTACTTGTGCTCGCGAGATTCATCAGTTCGATTCCTTGGTCGTTTCTTCACCGGCGTAAATCATGACAACT
TCAAAGAGGCTCGCAGACAGGAAGATTGAGAGGTTTGACAAGAACATTACTAAAAGAGGTTTTGTTCCTGAGACCACCACCAAGAA
GGGCAAGGATTACCCTGTCGGTCCCATCCTCCTCGGCTTCTTTGTCTTCGTCGTCATTGGTTCATCTCTCTTCCAGATCATCAGGA
CCGCAACAAGCAAAGGCATGGCGTAAACGGAATCACTGTTCAAGCTTAGAGGAAGCGATGTTTTCAAGATTACTCTTCTTCTTCTT
CTGTCTTGACTGTTTTTCCCTTATACTGTAGAATGCGTTAACTTTCTGTTTACTTACATGTTATGAAGAATTTTGAGACTACTTTT
TTTATAAATTATCCAATGTTTAAAATCTTGTCTTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAT38818 membrane protein [Brassica juncea]3292e-029
NP_564277 Ribosome associated membrane protein RAMP4 [Arabidopsis thaliana]3265e-029
AAF99731 F17L21.12 [Arabidopsis thaliana]3212e-028
ACU16910 unknown [Glycine max]3202e-028
XP_002514902 stress associated endoplasmic reticulum protein, putative [Ricinus communis]3167e-028

Swiss-Prot top hits (Blast detail)Scoree value
Q3T073 Stress-associated endoplasmic reticulum protein 21339e-008
Q8N6R1 Stress-associated endoplasmic reticulum protein 21339e-008
Q6TAW2 Stress-associated endoplasmic reticulum protein 21339e-008

TrEMBL top hits (Blast detail)Scoree value
Q2M5F0 Membrane protein3292e-029
Q84K46 At1g273303263e-029
Q9FZK2 F17L21.123211e-028
C6T5A8 Putative uncharacterized protein3202e-028
B9RMD3 Stress associated endoplasmic reticulum protein, putative3165e-028

Arabidopsis top hits (Blast detail)Scoree value
AT1G27350.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).3273e-031
AT1G27330.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27350.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).3273e-031

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  100%

Unigene MembersMember information