|
Information for unigene UN48533
FASTA Sequence |
Unigene ID: UN48533 | Length: 465 |
SSR | | CGCGGAGAGGTTATACTACTTGTGCTCGCGAGATTCATCAGTTCGATTCCTTGGTCGTTTCTTCACCGGCGTAAATCATGACAACT
TCAAAGAGGCTCGCAGACAGGAAGATTGAGAGGTTTGACAAGAACATTACTAAAAGAGGTTTTGTTCCTGAGACCACCACCAAGAA
GGGCAAGGATTACCCTGTCGGTCCCATCCTCCTCGGCTTCTTTGTCTTCGTCGTCATTGGTTCATCTCTCTTCCAGATCATCAGGA
CCGCAACAAGCAAAGGCATGGCGTAAACGGAATCACTGTTCAAGCTTAGAGGAAGCGATGTTTTCAAGATTACTCTTCTTCTTCTT
CTGTCTTGACTGTTTTTCCCTTATACTGTAGAATGCGTTAACTTTCTGTTTACTTACATGTTATGAAGAATTTTGAGACTACTTTT
TTTATAAATTATCCAATGTTTAAAATCTTGTCTTG
|
|
|
GenBank top hits (Blast detail) | Score | e value |
AAT38818 membrane protein [Brassica juncea] | 329 | 2e-029 |
NP_564277 Ribosome associated membrane protein RAMP4 [Arabidopsis thaliana] | 326 | 5e-029 |
AAF99731 F17L21.12 [Arabidopsis thaliana] | 321 | 2e-028 |
ACU16910 unknown [Glycine max] | 320 | 2e-028 |
XP_002514902 stress associated endoplasmic reticulum protein, putative [Ricinus communis] | 316 | 7e-028 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q3T073 Stress-associated endoplasmic reticulum protein 2 | 133 | 9e-008 |
Q8N6R1 Stress-associated endoplasmic reticulum protein 2 | 133 | 9e-008 |
Q6TAW2 Stress-associated endoplasmic reticulum protein 2 | 133 | 9e-008 |
TrEMBL top hits (Blast detail) | Score | e value |
Q2M5F0 Membrane protein | 329 | 2e-029 |
Q84K46 At1g27330 | 326 | 3e-029 |
Q9FZK2 F17L21.12 | 321 | 1e-028 |
C6T5A8 Putative uncharacterized protein | 320 | 2e-028 |
B9RMD3 Stress associated endoplasmic reticulum protein, putative | 316 | 5e-028 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT1G27350.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). | 327 | 3e-031 |
AT1G27330.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27350.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). | 327 | 3e-031 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
|
|