Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN51757

FASTA Sequence
Unigene ID: UN51757Length: 754  SNP
CTCACACAGAAACGCAAAAACACAATGACTAACGTTGCAGTAATAGCCGCTATTCTGATTGCAGCATTGTTATCAGCTAGCGTGAC
AGAACAAATGGCTCCATCTCCTTCCTCAGGACCTTCGGTTGAACCAGACTGCATGACGAATCTGTTGAACATGACGGACTGTCTTT
CGTACGTGCAGGTAGGAAACCGTGGTGGTGCGGCCAATCCAGACAAATCTTGTTGTCCGGAGCTTGCCGGCCTTGTCGATAACTCG
CCACAATGCCTCTGCTACCTACTCGGCGGAGATATGGAGGTTCAGTATGGAATCAAGATTGATAAGGCAAAGGCTCTCAAGCTTCC
CGGAGTTTGTGGCGTCGTTACTCCAGATCCCTCACTATGTTCACTGTTTGGAATTCCAGTTGGAGCACCGGAAGCTATGGGCAACG
AGGAATCCTCCCCAGCCTTCGCTCCAACTTCAGGTGCTGAATCACCAGAAGGCTTAGCATCGGGTCCATCGGCTAGCAGGATGAGC
GATGCACGAAACACTGCACCTTATTCTCTTTTTCTCAGTATCTTCTGCATTTCATCTATAATCCTGATTTCCTTTTCTTTTTAGCG
ACTCCATTATTTGTATTGTATTTTCCTATAAAAGAAGTATTGTTGCTTTTGGTAGGTTATTTTCCTGAATTTAATACTTTGTATTT
TATGGATTATTTCATCATTCATCTTACTAAATAAAGATTGTCATCTTAAAATTAAAAAGAAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_001030803 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin-like protein [Arabidopsis thaliana]6793e-069
NP_189958 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin-like protein [Arabidopsis thaliana]6793e-069
AAM66942 lipid-transfer protein-like protein [Arabidopsis thaliana]6731e-068
BAH56934 AT3G43720 [Arabidopsis thaliana]6623e-067
XP_002877294 lipid binding protein [Arabidopsis lyrata subsp. lyrata]6452e-065

Swiss-Prot top hits (Blast detail)Scoree value
Q9ZVC7 Xylogen-like protein 113081e-027
Q9ZQI8 Non-specific lipid-transfer protein-like protein At2g138201664e-011
Q8VYI9 Non-specific lipid-transfer protein-like protein At5g640801611e-010

TrEMBL top hits (Blast detail)Scoree value
Q2V3R4 Putative uncharacterized protein At3g43720.26792e-069
Q9LZH5 Lipid-transfer-like protein6792e-069
Q8L962 Lipid-transfer protein-like protein6739e-069
C0Z2K5 AT3G43720 protein6622e-067
C6SY96 Putative uncharacterized protein3387e-030

Arabidopsis top hits (Blast detail)Scoree value
AT3G43720.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein6791e-071
AT3G43720.2 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein6791e-071
AT2G27130.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein3081e-028
AT1G03103.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2174e-018
AT2G48130.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein1979e-016

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
118  21%
 
78  21%
 
63  8%
 
85  13%
 
103  8%
 
128  21%
 
191  3%
 
92  5%

Unigene MembersMember information