Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN52529

FASTA Sequence
Unigene ID: UN52529Length: 564 SSR 
GGAAACGATCGATCAATCTGAATCTTCTCATTTTCCCCCTTTCATAGCTAGCTCTAGGGTATTCGAATCGAGAAGAGATGGGACAG
ACCCAGTACTCTGACAAATACTTCGACGATACTTTCGAGTACAGGCACGTCGTGCTTCCTCCTGAAGTCGCTAAGCTTCTTCCCAA
GAATCGTCTTCTCTCCGAAAATGAGTGGCGTGCGATTGGTGTGCAGCAGAGCCGTGGATGGGTTCATTACGCGATCCATCGTCCAG
AGCCACACATCATGCTGTTCAGGAGGACTCTCAATTACCAGCAGCAGCAGCAGGAGAACCAAGCTCAAAACGTGCTCGCTAAGTGA
ATCTGAGTTGTGCTGCGCTACAAACATTGGTTCTTGTTAGCTATTATGTTTCTTGTAAACATGGGTTTGTGAACCACAACCTCTAA
TAACTTTGTGTTCATGTTATCTATCCTTGGTTGGAGAAAAACATGCGAGTGAATGAGTGATAATCTGACTACTTTGATGTTATGAT
GCATTGTCTTTGTTCATCGTGGATTATTATATCGTGTTTCGTCTTAAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002879125 cdk-subunit 1 [Arabidopsis lyrata subsp. lyrata]4282e-040
NP_180363 cyclin-dependent kinases regulatory subunit 1 [Arabidopsis thaliana]4272e-040
BAF36296 hypothetical protein [Ipomoea trifida]4254e-040
XP_002523737 Cyclin-dependent kinases regulatory subunit, putative [Ricinus communis]4254e-040
AAS79576 putative CDK regulatory subunit [Ipomoea trifida]4201e-039

Swiss-Prot top hits (Blast detail)Scoree value
O23249 Cyclin-dependent kinases regulatory subunit 14323e-042
A2XCH8 Cyclin-dependent kinases regulatory subunit 13992e-038
Q6PS57 Cyclin-dependent kinases regulatory subunit 13992e-038
Q9SJJ5 Cyclin-dependent kinases regulatory subunit 23992e-038
P55933 Probable cyclin-dependent kinases regulatory subunit3104e-028

TrEMBL top hits (Blast detail)Scoree value
A0A8Z1 Putative uncharacterized protein4253e-040
B9SCL8 Cyclin-dependent kinases regulatory subunit, putative4253e-040
Q6JJ57 Putative CDK regulatory subunit4201e-039
Q6T300 Cyclin-dependent kinases regulatory subunit4172e-039
A9NIV3 Cyclin-dependent kinases regulatory subunit4137e-039

Arabidopsis top hits (Blast detail)Scoree value
AT2G27960.1 CKS1 (CYCLIN-DEPENDENT KINASE-SUBUNIT 1); cyclin-dependent protein kinase/ protein binding4332e-043
AT2G27970.1 CKS2 (CDK-subunit 2); cyclin-dependent protein kinase/ cyclin-dependent protein kinase regulator3992e-039

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members